ID: 1039723347

View in Genome Browser
Species Human (GRCh38)
Location 8:40188483-40188505
Sequence TGAGTGCTTCCTGATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039723347_1039723352 3 Left 1039723347 8:40188483-40188505 CCTCCCTCATCAGGAAGCACTCA No data
Right 1039723352 8:40188509-40188531 AAAATGCCATCAAGAAAGGAAGG No data
1039723347_1039723350 -1 Left 1039723347 8:40188483-40188505 CCTCCCTCATCAGGAAGCACTCA No data
Right 1039723350 8:40188505-40188527 ATCCAAAATGCCATCAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039723347 Original CRISPR TGAGTGCTTCCTGATGAGGG AGG (reversed) Intergenic
No off target data available for this crispr