ID: 1039730086

View in Genome Browser
Species Human (GRCh38)
Location 8:40265558-40265580
Sequence CAGTATGCACATATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039730079_1039730086 10 Left 1039730079 8:40265525-40265547 CCTTTCCAGAGATTATGGCCCAA No data
Right 1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG No data
1039730080_1039730086 5 Left 1039730080 8:40265530-40265552 CCAGAGATTATGGCCCAATTAGG No data
Right 1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG No data
1039730082_1039730086 -8 Left 1039730082 8:40265543-40265565 CCCAATTAGGATATGCAGTATGC No data
Right 1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG No data
1039730083_1039730086 -9 Left 1039730083 8:40265544-40265566 CCAATTAGGATATGCAGTATGCA No data
Right 1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039730086 Original CRISPR CAGTATGCACATATGGAGGC TGG Intergenic
No off target data available for this crispr