ID: 1039734246

View in Genome Browser
Species Human (GRCh38)
Location 8:40313877-40313899
Sequence GAAAGTGCACAGATGGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039734246_1039734249 4 Left 1039734246 8:40313877-40313899 CCTAGGCCCATCTGTGCACTTTC No data
Right 1039734249 8:40313904-40313926 AAAATCCAGTTTTATCGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039734246 Original CRISPR GAAAGTGCACAGATGGGCCT AGG (reversed) Intergenic
No off target data available for this crispr