ID: 1039738347

View in Genome Browser
Species Human (GRCh38)
Location 8:40356402-40356424
Sequence GAGTAGTGACCTTTGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039738347_1039738353 23 Left 1039738347 8:40356402-40356424 CCTTTGATCAAAGGTCACTACTC No data
Right 1039738353 8:40356448-40356470 TACTTCTGCCTTGCCTGGTTGGG No data
1039738347_1039738350 18 Left 1039738347 8:40356402-40356424 CCTTTGATCAAAGGTCACTACTC No data
Right 1039738350 8:40356443-40356465 CTGCCTACTTCTGCCTTGCCTGG No data
1039738347_1039738352 22 Left 1039738347 8:40356402-40356424 CCTTTGATCAAAGGTCACTACTC No data
Right 1039738352 8:40356447-40356469 CTACTTCTGCCTTGCCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039738347 Original CRISPR GAGTAGTGACCTTTGATCAA AGG (reversed) Intergenic
No off target data available for this crispr