ID: 1039743950

View in Genome Browser
Species Human (GRCh38)
Location 8:40406966-40406988
Sequence CTGTCTAAAGGGATGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039743950_1039743958 3 Left 1039743950 8:40406966-40406988 CCTGCCAACATCCCTTTAGACAG No data
Right 1039743958 8:40406992-40407014 CCGATTTGATTCTTTTCCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039743950 Original CRISPR CTGTCTAAAGGGATGTTGGC AGG (reversed) Intergenic
No off target data available for this crispr