ID: 1039749625

View in Genome Browser
Species Human (GRCh38)
Location 8:40465112-40465134
Sequence GTTTACTTCCTCACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039749625_1039749632 29 Left 1039749625 8:40465112-40465134 CCTTCCTCAGTGAGGAAGTAAAC No data
Right 1039749632 8:40465164-40465186 ATCCAAGATTGGGGATTCGATGG No data
1039749625_1039749630 20 Left 1039749625 8:40465112-40465134 CCTTCCTCAGTGAGGAAGTAAAC No data
Right 1039749630 8:40465155-40465177 ATGACCGACATCCAAGATTGGGG No data
1039749625_1039749628 18 Left 1039749625 8:40465112-40465134 CCTTCCTCAGTGAGGAAGTAAAC No data
Right 1039749628 8:40465153-40465175 GAATGACCGACATCCAAGATTGG No data
1039749625_1039749629 19 Left 1039749625 8:40465112-40465134 CCTTCCTCAGTGAGGAAGTAAAC No data
Right 1039749629 8:40465154-40465176 AATGACCGACATCCAAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039749625 Original CRISPR GTTTACTTCCTCACTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr