ID: 1039750637

View in Genome Browser
Species Human (GRCh38)
Location 8:40475183-40475205
Sequence CTTCAGATGGGGCAGCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039750637_1039750642 8 Left 1039750637 8:40475183-40475205 CCTGTTTGCTGCCCCATCTGAAG No data
Right 1039750642 8:40475214-40475236 AATGCTTTCATGCTAAGAGGTGG No data
1039750637_1039750641 5 Left 1039750637 8:40475183-40475205 CCTGTTTGCTGCCCCATCTGAAG No data
Right 1039750641 8:40475211-40475233 CGAAATGCTTTCATGCTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039750637 Original CRISPR CTTCAGATGGGGCAGCAAAC AGG (reversed) Intergenic
No off target data available for this crispr