ID: 1039758996

View in Genome Browser
Species Human (GRCh38)
Location 8:40553703-40553725
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039758992_1039758996 17 Left 1039758992 8:40553663-40553685 CCATTGTATAGATGATACTAAGT 0: 1
1: 0
2: 0
3: 20
4: 190
Right 1039758996 8:40553703-40553725 TAGATAATGAATGATATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr