ID: 1039763681

View in Genome Browser
Species Human (GRCh38)
Location 8:40606038-40606060
Sequence TCACATAAACTGAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2290
Summary {0: 5, 1: 338, 2: 491, 3: 463, 4: 993}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039763681_1039763686 24 Left 1039763681 8:40606038-40606060 CCCTTTACCTTCAGTTTATGTGA 0: 5
1: 338
2: 491
3: 463
4: 993
Right 1039763686 8:40606085-40606107 TCTTGAAGACAGTGGATACTTGG No data
1039763681_1039763685 16 Left 1039763681 8:40606038-40606060 CCCTTTACCTTCAGTTTATGTGA 0: 5
1: 338
2: 491
3: 463
4: 993
Right 1039763685 8:40606077-40606099 GATTAGTCTCTTGAAGACAGTGG No data
1039763681_1039763687 28 Left 1039763681 8:40606038-40606060 CCCTTTACCTTCAGTTTATGTGA 0: 5
1: 338
2: 491
3: 463
4: 993
Right 1039763687 8:40606089-40606111 GAAGACAGTGGATACTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039763681 Original CRISPR TCACATAAACTGAAGGTAAA GGG (reversed) Intronic
Too many off-targets to display for this crispr