ID: 1039763681 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:40606038-40606060 |
Sequence | TCACATAAACTGAAGGTAAA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 2290 | |||
Summary | {0: 5, 1: 338, 2: 491, 3: 463, 4: 993} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1039763681_1039763686 | 24 | Left | 1039763681 | 8:40606038-40606060 | CCCTTTACCTTCAGTTTATGTGA | 0: 5 1: 338 2: 491 3: 463 4: 993 |
||
Right | 1039763686 | 8:40606085-40606107 | TCTTGAAGACAGTGGATACTTGG | No data | ||||
1039763681_1039763685 | 16 | Left | 1039763681 | 8:40606038-40606060 | CCCTTTACCTTCAGTTTATGTGA | 0: 5 1: 338 2: 491 3: 463 4: 993 |
||
Right | 1039763685 | 8:40606077-40606099 | GATTAGTCTCTTGAAGACAGTGG | No data | ||||
1039763681_1039763687 | 28 | Left | 1039763681 | 8:40606038-40606060 | CCCTTTACCTTCAGTTTATGTGA | 0: 5 1: 338 2: 491 3: 463 4: 993 |
||
Right | 1039763687 | 8:40606089-40606111 | GAAGACAGTGGATACTTGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1039763681 | Original CRISPR | TCACATAAACTGAAGGTAAA GGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |