ID: 1039763682

View in Genome Browser
Species Human (GRCh38)
Location 8:40606039-40606061
Sequence CTCACATAAACTGAAGGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2036
Summary {0: 4, 1: 327, 2: 470, 3: 415, 4: 820}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039763682_1039763686 23 Left 1039763682 8:40606039-40606061 CCTTTACCTTCAGTTTATGTGAG 0: 4
1: 327
2: 470
3: 415
4: 820
Right 1039763686 8:40606085-40606107 TCTTGAAGACAGTGGATACTTGG No data
1039763682_1039763685 15 Left 1039763682 8:40606039-40606061 CCTTTACCTTCAGTTTATGTGAG 0: 4
1: 327
2: 470
3: 415
4: 820
Right 1039763685 8:40606077-40606099 GATTAGTCTCTTGAAGACAGTGG No data
1039763682_1039763687 27 Left 1039763682 8:40606039-40606061 CCTTTACCTTCAGTTTATGTGAG 0: 4
1: 327
2: 470
3: 415
4: 820
Right 1039763687 8:40606089-40606111 GAAGACAGTGGATACTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039763682 Original CRISPR CTCACATAAACTGAAGGTAA AGG (reversed) Intronic
Too many off-targets to display for this crispr