ID: 1039763683

View in Genome Browser
Species Human (GRCh38)
Location 8:40606045-40606067
Sequence TAAGGACTCACATAAACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1442
Summary {0: 4, 1: 293, 2: 418, 3: 321, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039763683_1039763685 9 Left 1039763683 8:40606045-40606067 CCTTCAGTTTATGTGAGTCCTTA 0: 4
1: 293
2: 418
3: 321
4: 406
Right 1039763685 8:40606077-40606099 GATTAGTCTCTTGAAGACAGTGG No data
1039763683_1039763686 17 Left 1039763683 8:40606045-40606067 CCTTCAGTTTATGTGAGTCCTTA 0: 4
1: 293
2: 418
3: 321
4: 406
Right 1039763686 8:40606085-40606107 TCTTGAAGACAGTGGATACTTGG No data
1039763683_1039763687 21 Left 1039763683 8:40606045-40606067 CCTTCAGTTTATGTGAGTCCTTA 0: 4
1: 293
2: 418
3: 321
4: 406
Right 1039763687 8:40606089-40606111 GAAGACAGTGGATACTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039763683 Original CRISPR TAAGGACTCACATAAACTGA AGG (reversed) Intronic
900699544 1:4036233-4036255 TAAGGACTCACATAAACTTAAGG + Intergenic
902969384 1:20035591-20035613 TAAGGACTCACTTAAACTTAAGG - Intronic
905497610 1:38405531-38405553 TAAGGACTCACATAAACATAAGG + Intergenic
906594704 1:47064817-47064839 TAAGGACTGACATGAACTTAAGG + Intergenic
906869363 1:49460461-49460483 TGAGGACTCACATAAATCTAAGG - Intronic
906894501 1:49756690-49756712 TAAGTTCTCACAAAATCTGATGG + Intronic
906914845 1:49997324-49997346 TAAGGACTCACAAAAACTCAAGG + Intronic
907001420 1:50862662-50862684 TAAAGACTCACACAAACTTAAGG + Intronic
907633586 1:56109200-56109222 TAAGGACTCACATAAACTTCAGG + Intergenic
908298763 1:62740041-62740063 TAAGGACTCACATAAAGTAAAGG + Intergenic
908660492 1:66430076-66430098 TAAGGACTCACATAAACTTAAGG - Intergenic
908803443 1:67905004-67905026 TAAGGACTCACATAAGCTTAAGG - Intergenic
908862126 1:68500889-68500911 TAAGGACTCACATAAACTTAAGG + Intergenic
908883623 1:68761376-68761398 TAAGGACTCACATAAACTTAAGG + Intergenic
908890598 1:68843365-68843387 TAAGGACTCACATAAACTTAAGG - Intergenic
908981983 1:69969399-69969421 TAAGGACTCACATAAACTTAAGG + Intronic
909405670 1:75286343-75286365 TAAGGACTCACATGAACTTAAGG - Intronic
909511162 1:76454152-76454174 TAAGGACTCTTCTAAACTTAAGG - Intronic
909828160 1:80152337-80152359 TAAAGACTCACATAAATTTAAGG - Intergenic
909860268 1:80595961-80595983 TAAGGAGTCACGTAAACTTAAGG + Intergenic
910232915 1:85005015-85005037 TAAGGACTCACATAAACTTAAGG + Intronic
910323671 1:85978489-85978511 TAAGGACTCAAATAAACCTAAGG + Intronic
910919388 1:92327528-92327550 TAAGGATTCACATAAACTTAAGG - Intronic
911065905 1:93788179-93788201 TAAGGACTCACATAAAGAGGTGG - Intronic
911265692 1:95740973-95740995 TAAGGACTCATATAAACTTAAGG - Intergenic
911318056 1:96378415-96378437 TAAGGACGCAAATAAACTTAAGG + Intergenic
911322518 1:96432528-96432550 TAAAGACTCACAAAAACTTAAGG - Intergenic
911689336 1:100814276-100814298 TAAGGACTCACATAAACTTAAGG + Intergenic
911743459 1:101412866-101412888 TAAGGACTCACATAAAATTAAGG + Intergenic
912082144 1:105950021-105950043 CAAAGATTCACATAAACTTAAGG - Intergenic
912612263 1:111060228-111060250 TGAGGACTCACATAAATTTAAGG - Intergenic
912615952 1:111100314-111100336 ATAGGACTCACATAAAGTAAAGG - Intergenic
913035619 1:114962532-114962554 TACAGACTCACATAAACTTAAGG - Intronic
913151554 1:116048869-116048891 TAAGGACTCACATAAACTTAAGG + Intronic
913236375 1:116787174-116787196 TAAGGACTCACATAAACTTAAGG + Intergenic
913337299 1:117720537-117720559 TATGGACTCACATAAACTTAAGG + Intergenic
913339543 1:117745208-117745230 TAAGGACTCACATGAACTTAAGG - Intergenic
913463939 1:119119194-119119216 TAAAGACTCACATAAAGTAAAGG + Intronic
913493710 1:119407000-119407022 TAAGGACTCATATAAACTTAGGG + Intergenic
913588009 1:120295271-120295293 TAAGGACTCACATAAACTTAAGG - Intergenic
913620176 1:120603098-120603120 TAAGGACTCACATAAACTTAAGG + Intergenic
913972855 1:143428735-143428757 TAATGACTTACATAAACTTAAGG - Intergenic
914067239 1:144254343-144254365 TAATGACTTACATAAACTTAAGG - Intergenic
914111914 1:144712011-144712033 TAATGACTTACATAAACTTAAGG + Intergenic
914570025 1:148907144-148907166 TAAGGACTCACATAAACTTAAGG - Intronic
914602804 1:149223125-149223147 TAAGGACTCACATAAACTTAAGG + Intergenic
915219083 1:154359578-154359600 TAAGTACTCACAAGATCTGATGG - Intergenic
915821449 1:159028859-159028881 TAAGGCCTCACATAAACATAAGG - Intronic
915972127 1:160362421-160362443 GAAGGAGTTAGATAAACTGAGGG + Intergenic
915999746 1:160604070-160604092 TAAGGACTAACATAAACTTAAGG - Intergenic
916331506 1:163623014-163623036 TAAAGACTCATATAAACCTAAGG - Intergenic
916566162 1:165980479-165980501 TTAGGACTCACATGAACATAAGG - Intergenic
916866693 1:168867523-168867545 TTAGAACTCACATAAACTTCAGG - Intergenic
916868920 1:168890727-168890749 TAAGAATTCATATAAACTCAAGG + Intergenic
916872975 1:168937700-168937722 TAAGGACTCACAAAAACCTAAGG - Intergenic
916903037 1:169251348-169251370 TAAAGATTCATATAAACTTAGGG - Intronic
917351396 1:174081886-174081908 TAAGGACTCACATAAACTTAAGG + Intergenic
917607616 1:176650260-176650282 TAAAGACACACATAAACTGAAGG - Intronic
917913457 1:179676224-179676246 TAAGGACTCACAGAAACTTAAGG - Intronic
918721648 1:187859846-187859868 TAAGGAATCATATAAACTTAAGG - Intergenic
918819561 1:189235273-189235295 TATGGACTCACATAAACTTGAGG - Intergenic
919214291 1:194532700-194532722 TAAGGACTCACATAAACTTAAGG - Intergenic
919281331 1:195493614-195493636 TAAGGACTCACATAAACTTAAGG - Intergenic
919397778 1:197071881-197071903 TATGGACTCACATAAACTTAAGG + Intergenic
919430883 1:197489788-197489810 TAAGGACTCACACAAACCTAAGG + Intergenic
919485488 1:198141447-198141469 TAAGGATTCACATAAACTTAAGG - Intergenic
919524963 1:198635575-198635597 TAAGAAGTCACATAATATGAGGG + Intergenic
919571724 1:199257234-199257256 CAAGGACTCACATAAACTTAAGG - Intergenic
919851030 1:201672889-201672911 TGTGGACGCACATAGACTGATGG + Intronic
920800125 1:209178873-209178895 TAAGGACTTACATAAACTTAAGG + Intergenic
920990015 1:210927828-210927850 CAGGGCCTCACATAAACTTAAGG + Intronic
921196629 1:212763552-212763574 TAAGGACTCATAAAAATTTAAGG + Intronic
921242310 1:213197824-213197846 TACGGACGCACATAAATTTAAGG - Intronic
921532697 1:216305383-216305405 TAAGGACTCACATAAACTTAAGG - Intronic
921690397 1:218141971-218141993 CAAGTACTCACATAAACTTCAGG + Intergenic
921762703 1:218935457-218935479 TAAGGGCTCACATAAACTTAAGG - Intergenic
921834710 1:219766007-219766029 TCAGGACTCACATAAAGTAAAGG + Intronic
921999978 1:221467214-221467236 AAAGGATTCACATAAACTTAAGG - Intergenic
922673187 1:227530557-227530579 TAAGGACTCACATAAACTTAAGG - Intergenic
923174367 1:231448878-231448900 TAAGGACTCACATAAACTTAAGG + Intergenic
923458937 1:234190337-234190359 TAAGGACTCACATAAACTTAAGG + Intronic
923691742 1:236200714-236200736 TAAGTACTCACATAAACTTAAGG - Intronic
923723262 1:236485098-236485120 TAAAGACCTACAGAAACTGATGG + Intergenic
923960927 1:239083011-239083033 TAAGGACTCACATAAACTTAAGG - Intergenic
924193053 1:241576133-241576155 ATAGGACTCACACAAACTCAAGG - Intronic
924321212 1:242853009-242853031 TAAGGACTCATATAAAGGGGTGG - Intergenic
924691734 1:246358083-246358105 TAAGGACTCACATAAACTTAAGG + Intronic
924767807 1:247050400-247050422 TAAGGACTCACATAAACCTAAGG - Intronic
924829780 1:247581246-247581268 TAAAAACCCACATAAACTTAAGG + Intergenic
924930088 1:248722942-248722964 TAAGGACTCACATAAACTTAAGG + Intronic
1062761004 10:19058-19080 TAACGACTTACATAAACTTAAGG + Intergenic
1063561104 10:7128696-7128718 TAAAGACTCACATAAACTTATGG - Intergenic
1064557024 10:16557590-16557612 TAAGGACTCACATAAACTTAAGG - Intergenic
1065418354 10:25514378-25514400 TAAGGACTCACATAAACTTAAGG - Intronic
1065462580 10:25984381-25984403 TAAGAACTCGCAAAAACTTAAGG + Intronic
1065894389 10:30150229-30150251 CAAGTACTCACATAAACTTAAGG - Intergenic
1066164383 10:32770958-32770980 GAAGGATTCATATAAACTCAAGG - Intronic
1066170546 10:32839276-32839298 TAAAGACTCACATAAACTTAAGG + Intronic
1066651072 10:37655700-37655722 TAAGGACTCACATAAACTTAAGG + Intergenic
1066747283 10:38613553-38613575 TAACAACTTACATAAACTTAAGG + Intergenic
1067234019 10:44432927-44432949 TGAAGACTCACATAAACTTAAGG - Intergenic
1067895189 10:50171505-50171527 GAAGGATTCATATAAACTCAAGG + Intergenic
1067953796 10:50770471-50770493 GAAGGATTCATATAAACTCAAGG - Intronic
1068122656 10:52799531-52799553 TAAGGACTCACATAAACTGAAGG - Intergenic
1068157223 10:53215791-53215813 TAAGGACTCACTTAAACTTAAGG - Intergenic
1068172929 10:53419855-53419877 TAAGAACTCACATAAACTTAAGG - Intergenic
1068924832 10:62525231-62525253 CAAGGACTCACATAAACTTAAGG - Intronic
1069113082 10:64470409-64470431 TAAGGACTTACAGAAACTTAAGG + Intergenic
1069127813 10:64659601-64659623 CAGGGACTCTCATACACTGACGG - Intergenic
1069129389 10:64680288-64680310 TAAGGATTCACATAAACTTAAGG - Intergenic
1069199919 10:65600522-65600544 TAAGGACTCACATAAACTTAAGG - Intergenic
1070292448 10:75127306-75127328 TACTGCCTCACATGAACTGAGGG - Intronic
1071015686 10:80994951-80994973 TAAGGACTCATATAAACTTAAGG - Intergenic
1071023997 10:81091071-81091093 TAAGGACTCACATAAACTTAAGG - Intergenic
1071058400 10:81539293-81539315 TAAGGACTCACATAAGGCTAAGG - Intergenic
1071761483 10:88612503-88612525 TAAGATCTCACAGAAACTCAAGG + Intergenic
1072381572 10:94877767-94877789 TAAGGACTCACATAAACTTAAGG - Intergenic
1072423084 10:95306046-95306068 AAAGAACTCAAAGAAACTGAGGG + Intergenic
1072769067 10:98122169-98122191 TAAGAACTCACATAAATTTAAGG - Intergenic
1072815099 10:98499794-98499816 TAAGGACTCACATAAAGTAAAGG + Intronic
1072871912 10:99128916-99128938 TAACAACTCACATCAACTTAAGG + Intronic
1072981957 10:100105887-100105909 AAGGGACTCTCATAAACTGCTGG + Intergenic
1073701098 10:105927525-105927547 TAAGGGCTCACATAAACTTAAGG + Intergenic
1073741892 10:106416810-106416832 TAAGGACTCACATAAACTTAAGG + Intergenic
1074037185 10:109752053-109752075 TAAGGACTCACATAAACTTAAGG - Intergenic
1075157949 10:119995603-119995625 TAAGGACTCACATAAATTTAAGG - Intergenic
1075493981 10:122902342-122902364 TAAGGACTCACATAACCTTGAGG + Intergenic
1076353243 10:129832847-129832869 TGGGGACTCACCGAAACTGACGG + Intergenic
1076376115 10:129986560-129986582 TAAGAACTCACATAAACTTCAGG + Intergenic
1076516219 10:131045918-131045940 TTAGGAATCTCATAAAATGATGG + Intergenic
1076665401 10:132086731-132086753 TAAGGACTCACATAAACTTAAGG - Intergenic
1077774990 11:5260646-5260668 TAAGGACTCACATAAACTTAAGG + Intronic
1077834047 11:5908457-5908479 TCAGGACTCATATAAACTTAAGG - Intronic
1078288792 11:9985222-9985244 TAACGACTCACATAAACTTAAGG + Intronic
1078687146 11:13544169-13544191 TACGGACTCACAAAAACTTAAGG + Intergenic
1078991386 11:16649902-16649924 TAAGGACTCACATAACCGAAAGG + Intronic
1079179697 11:18179527-18179549 TAAGGACTCACATAAACTTAAGG + Intronic
1079207857 11:18432824-18432846 CAAGGACTCACATAAAGGGGTGG - Intronic
1079463989 11:20711254-20711276 TAAGGACTCACACTAACTAAAGG - Intronic
1079634131 11:22714142-22714164 TAAGTACTCACCTAAACTTAAGG + Intronic
1079805839 11:24930102-24930124 AAAAGACTCAAATAAACTTAAGG - Intronic
1079856189 11:25608654-25608676 TAAGGACTCACATAAACTTAAGG - Intergenic
1079951976 11:26817374-26817396 TAAGGACTCACATAAAATTAAGG - Intergenic
1080203155 11:29697646-29697668 TAAGGACTCACATAGACTTAAGG - Intergenic
1080585677 11:33680718-33680740 TAAAGACTCACATAAACTTAAGG - Intergenic
1080748928 11:35135098-35135120 TCAGGAATCACATGAACTGGTGG - Intergenic
1080863889 11:36176169-36176191 TAAGGACTCACATAAACTTAAGG - Intronic
1081009570 11:37792231-37792253 TAAGGACTCAGACAAACTTAAGG - Intergenic
1081090892 11:38865288-38865310 TAAGGACCCATATAAACTTCAGG - Intergenic
1081326494 11:41752110-41752132 TGAGGACTCACATAAACTTAAGG - Intergenic
1081814799 11:45932786-45932808 CAAGGACTCACAAAGACTCACGG + Intronic
1082104176 11:48202022-48202044 TACAGACTCACATAAACTTAAGG + Intergenic
1082120682 11:48376625-48376647 TAAGAACTCACATAAACCTGAGG - Intergenic
1082679984 11:56155371-56155393 TAAGGACTCACATAAACATAAGG + Intergenic
1083005594 11:59342753-59342775 TAAGAACTCACATAATCTTAAGG - Intergenic
1083193751 11:61070646-61070668 TAAGGAATCAGAGAGACTGAGGG + Intergenic
1083511711 11:63214850-63214872 TAAGGAATCAGAGAGACTGATGG - Intronic
1084004141 11:66314400-66314422 TGAGGACTCAGACAAACTGAAGG + Intergenic
1085240336 11:75048317-75048339 TACGGATTCACATAAACTTAAGG - Intergenic
1085917356 11:80905278-80905300 TAAGGATCCACACAAACTTAAGG + Intergenic
1086264781 11:84984753-84984775 TAAGGACTCACATAAACTTAAGG + Intronic
1086297793 11:85390122-85390144 TAACCACTCACATAAACTTAAGG + Intronic
1086563254 11:88193354-88193376 AAAGGACACACATACACTGCTGG - Intergenic
1086825176 11:91487549-91487571 TAAAGACTCACATAAAGTAAAGG - Intergenic
1086844613 11:91732912-91732934 TAAGGACTCACACAAACTTAAGG + Intergenic
1086997707 11:93377487-93377509 TAAGGACTCACACAAACTTAAGG - Intronic
1087090435 11:94265658-94265680 TAAGAACTCAAGTAAACTTAAGG + Intergenic
1087381681 11:97411706-97411728 TAAGGACACACACAATTTGAAGG + Intergenic
1087469059 11:98547800-98547822 TAAGGACTCACATAAACTTAAGG + Intergenic
1087602254 11:100331100-100331122 TGAGGACTCATATAAACTTAAGG + Intronic
1087631036 11:100650428-100650450 TAAGGACTCATGTAAACTTAAGG + Intergenic
1087688749 11:101295692-101295714 CTAGGACTCACATAAACTTAAGG - Intergenic
1087853309 11:103058987-103059009 TAAGGCATCAAATAAATTGAGGG - Intergenic
1087866015 11:103228056-103228078 TAAGGACTCTCATAAACTTAAGG - Intronic
1087886532 11:103489274-103489296 TAAGAACTCATATAAACTGTTGG - Intergenic
1087907884 11:103720686-103720708 TTACGACACACATAAACTTAAGG + Intergenic
1087977968 11:104573988-104574010 TTAAGACTCACATAAAATGTGGG - Intergenic
1088179657 11:107094566-107094588 TAAGGACTCATATAAACTTAAGG + Intergenic
1088372268 11:109104755-109104777 TAAGAACTCACAGAAACTTAAGG - Intergenic
1088387263 11:109273506-109273528 TAAGGACTCACAGAAACTTAAGG - Intergenic
1088413317 11:109560990-109561012 TAAGGGTTCATATAAACTCAAGG - Intergenic
1088413600 11:109565220-109565242 TAAGGACTCACATAAACTTAAGG - Intergenic
1088525786 11:110752698-110752720 TAAGGACTCACATAAACTTAGGG - Intergenic
1088552645 11:111029001-111029023 TAAGGATTCTTATAAACTCAAGG + Intergenic
1088580728 11:111313328-111313350 TAAGAACTCACATAAACTTAAGG + Intergenic
1088653023 11:111975084-111975106 TAAAGCCAAACATAAACTGAGGG - Exonic
1088829191 11:113520860-113520882 AAAGCACTCACATTTACTGAAGG - Intergenic
1088951344 11:114573484-114573506 TAAGAACTCACATAAACTTAAGG + Intronic
1089213510 11:116821760-116821782 CAAGGACTCGGAGAAACTGAAGG - Exonic
1089837150 11:121380988-121381010 TAAGGACTCACATAAATTTAGGG + Intergenic
1090545440 11:127761330-127761352 ATAAGACTCACATAAACTTAAGG + Intergenic
1090559297 11:127913385-127913407 TAAGAACTCACATAAACTTAAGG - Intergenic
1090682871 11:129079870-129079892 CAAGGACTCACATAAACTTAAGG + Intronic
1090756901 11:129800039-129800061 TAAAAACTCACATAAACTTAAGG + Intergenic
1091196550 11:133736334-133736356 TGAGCTCTCACATAAACTAATGG + Intergenic
1091210275 11:133852318-133852340 TAAAGACTCACATAAAGTAAAGG - Intergenic
1091380979 12:59187-59209 TAAGGACTCACATAAACTTAAGG + Intergenic
1092060247 12:5544747-5544769 TAAAGACTCACATAGACTTAAGG + Intronic
1092602861 12:10085414-10085436 TAAGGACTCACATAAACTTAAGG + Intronic
1092604651 12:10105058-10105080 TAAGGACTCATATAAATTCAAGG + Intronic
1092700178 12:11219838-11219860 TAAGGACTCACATAAACTTAAGG + Intergenic
1093001838 12:14005968-14005990 TAAGGACTCACATAAACTTAAGG - Intergenic
1093135970 12:15451102-15451124 TAAGGACTCACATAAACTTAAGG + Intronic
1093277750 12:17150600-17150622 TAACTACTCACATAAACTTAAGG + Intergenic
1093468858 12:19479849-19479871 TAAGGACTCAAATAAACTTAAGG - Intronic
1093533804 12:20199470-20199492 GAAGGATTCATATAAACTCAAGG - Intergenic
1093608390 12:21123165-21123187 TAAGGACTCACATAAACTTAAGG + Intronic
1093940173 12:25044545-25044567 TAAGTACATACATAAACTGAAGG + Intronic
1093951729 12:25169946-25169968 TAAGGACTCACATAAAGTAAAGG + Intronic
1093963951 12:25305301-25305323 TAAGGACTCATATAAACTTAAGG + Intergenic
1093991626 12:25594849-25594871 TAAGGATGCACATAAACTCAAGG + Intronic
1094032335 12:26026771-26026793 TAAGAACTCTCATACACTGTTGG + Intronic
1094263254 12:28525966-28525988 TATGGACTCACACAAACTTAAGG - Intronic
1094319120 12:29166359-29166381 CAGGGACTCACATAAAATAATGG - Intronic
1094808743 12:34116777-34116799 TAAGGACTTACATAAACTTAAGG + Intergenic
1095176517 12:39098036-39098058 TAAGGACTCACATAAACTTAAGG + Intergenic
1095225994 12:39677211-39677233 TAAGAATTCACATAAACTTAAGG + Intronic
1095500853 12:42837282-42837304 TAAGGACTCACATAAACTTAAGG - Intergenic
1095557589 12:43525641-43525663 CAAGGATTCATATAAACTCAAGG + Intronic
1095776326 12:46013941-46013963 TAAGGACACACATAAACTGAAGG - Intergenic
1095777018 12:46021296-46021318 TAAGGACTCTTACAAACTCAAGG - Intergenic
1095784677 12:46096425-46096447 TAAGGATGCACATAAACTCAAGG + Intergenic
1096437873 12:51610257-51610279 TAAGGACTCACATAAACTTCAGG - Intronic
1096956640 12:55532906-55532928 TAAGGGCTCACATAAACTGAAGG + Intergenic
1097362819 12:58677016-58677038 TAAAGACACATATAGACTGAAGG - Intronic
1097537185 12:60887377-60887399 TAAGGTATCACATAAACTTAAGG - Intergenic
1097581453 12:61462181-61462203 TGAGAATTCATATAAACTGAAGG + Intergenic
1097603832 12:61728600-61728622 TAAGGACTTACATAAACTTAAGG - Intronic
1097607316 12:61771013-61771035 TAAGGACACACATAAACTTAAGG + Intronic
1097659951 12:62418782-62418804 TAAGGACTGACATAAACTTAAGG + Intergenic
1097906780 12:64928551-64928573 TAAGGACTCACATAAACTTAAGG - Intergenic
1098500795 12:71189325-71189347 TAAGGATTCACATAAACTGAAGG + Intronic
1098518815 12:71411475-71411497 TAAGGACTGTCATAAACTTAAGG + Intronic
1098654539 12:73011439-73011461 TAAGGACTTACATAAACTTAAGG - Intergenic
1098786263 12:74760250-74760272 TAAGAACTCACATAAACTTAAGG - Intergenic
1098852437 12:75612875-75612897 TAAGGACTCACATAAACTTAAGG + Intergenic
1098867674 12:75781335-75781357 TAAGGACTCAGATGAAAAGATGG + Intergenic
1099042179 12:77669469-77669491 TCAGGACTCACATAAACTTAAGG + Intergenic
1099105667 12:78493157-78493179 TAAGGACTCAAGTAAACTGTGGG - Intergenic
1099382540 12:81972647-81972669 TAAGGACTCACATAAACTTAAGG + Intergenic
1099389246 12:82058632-82058654 TAAGGACTGAAATAAATTCATGG - Intergenic
1099392225 12:82095999-82096021 CAAGGACAAACATAAACTTAAGG - Intergenic
1099704158 12:86129096-86129118 TAAGGAATCAGAGAGACTGAGGG + Intronic
1100060134 12:90565558-90565580 TAAGTTCTCACAAAATCTGATGG - Intergenic
1100087945 12:90934772-90934794 TAAGGACTCACATAAAGTAAAGG - Intronic
1100697049 12:97106172-97106194 TAAAGACTCACACAAACTTAAGG - Intergenic
1100706495 12:97205619-97205641 TAAGAACTCACATAAACTTAAGG + Intergenic
1100918734 12:99457545-99457567 TAAGGACTCACATAAACGTAAGG + Intronic
1100920835 12:99484883-99484905 GAAGGATTCATATAAACTGAGGG - Intronic
1100937161 12:99681885-99681907 TAAGGACTCACATAAACTTAAGG + Intronic
1100951507 12:99855171-99855193 TAAGGACTCACATAAACTTAAGG + Intronic
1100970646 12:100066145-100066167 TAAGGACTCACACAAACTTAAGG + Intronic
1101290585 12:103363613-103363635 ATAGGACTCACACAAACTTAAGG + Intronic
1101298049 12:103446628-103446650 TAAGGACTCACATAAACTTAAGG + Intronic
1104524474 12:129505895-129505917 TAAGGACTCACATAAACTTAAGG - Intronic
1105315138 13:19251873-19251895 TAAGGACTCACATAAACTTAAGG + Intergenic
1105598679 13:21865339-21865361 TAAGGACTCACATAAACTTAAGG - Intergenic
1105990200 13:25612995-25613017 CAAGGACTCACATGAACTTAAGG - Intronic
1106060162 13:26282833-26282855 TAAGGACTCACATAAACTTAAGG + Intronic
1106378066 13:29209295-29209317 TAAGAACTCAAATCAACTTAAGG - Intronic
1106392053 13:29344521-29344543 TAAGGACTCACATAAACTTAAGG - Intronic
1106424746 13:29615824-29615846 TAAGGACTTACATAAACTTAAGG + Intergenic
1106572941 13:30945319-30945341 TAAGGATTCATATAAACCCAAGG - Intronic
1106894426 13:34283246-34283268 TAAGGACTCACATAAACTTAAGG - Intergenic
1106977956 13:35245168-35245190 TAAGGATTCACATAAAATTAAGG - Intronic
1107070914 13:36267720-36267742 GAAGGATTCATATAAACTCAAGG + Intronic
1107253123 13:38390276-38390298 TAAGAACTCACATAAACTCAAGG - Intergenic
1107361393 13:39621216-39621238 TAAGGACTCACATAAACATAAGG + Intergenic
1107426620 13:40300218-40300240 TACGGACTCATGTAAACTTAAGG - Intergenic
1108132083 13:47312339-47312361 ATAGGACTCACATAAACTTAAGG + Intergenic
1108134539 13:47341041-47341063 TAAGGACTCACATAAACTTAAGG + Intergenic
1108134743 13:47343519-47343541 TAAGGACTCACATAAACTTAAGG + Intergenic
1108298535 13:49051019-49051041 TAAGGACTAACATAAACTTAAGG - Intronic
1108398366 13:50012468-50012490 TAAAGATTCAGATAAAGTGAAGG + Exonic
1108831840 13:54488846-54488868 TAAGGACTCACATAAACTTAAGG + Intergenic
1108902268 13:55426097-55426119 TGAGGACTCACATAAACTTAAGG + Intergenic
1109047828 13:57436776-57436798 TAAGGAATCAGAGAGACTGAGGG + Intergenic
1109058132 13:57579224-57579246 TAAGGACTCACATAAACTTAAGG - Intergenic
1109201158 13:59433051-59433073 TAAGGACTTGCATAAACTTAAGG - Intergenic
1109483909 13:62994299-62994321 TAAGGATTCATATTAACTCAAGG - Intergenic
1109484746 13:63003823-63003845 TAAGGACTCACATAAACTTAAGG + Intergenic
1109567380 13:64134940-64134962 TAAGGACTCACATAAACTTAAGG - Intergenic
1109618084 13:64863167-64863189 TAAAAACTCACATAAACTTAAGG - Intergenic
1109625191 13:64964747-64964769 TAAGGACTCACAGAAACTTAAGG + Intergenic
1109804856 13:67425752-67425774 TAAGTTCTCACAAGAACTGATGG - Intergenic
1109822441 13:67675644-67675666 AAAGGACTCTCATGAACTTAAGG - Intergenic
1109824412 13:67698731-67698753 TAAGGACTCTCATAAACTTAAGG + Intergenic
1109975829 13:69830216-69830238 TAAAGACTCACATAAATTTAAGG + Intronic
1110182029 13:72628277-72628299 TAAGGACTCCAATAAACTTAAGG + Intergenic
1110504914 13:76274022-76274044 TAAGGACTCACATAAACCTAAGG + Intergenic
1110748264 13:79081342-79081364 TAAGGACTCACATAAACTTAAGG + Intergenic
1110755933 13:79173915-79173937 TAAGGACTCACATAAACTTAAGG + Intergenic
1110846415 13:80195066-80195088 TAAGGATGCACTTAAACGGAGGG + Intergenic
1111283216 13:86053813-86053835 TAAGGATTCACATAAACTTAAGG + Intergenic
1111748158 13:92295831-92295853 TAAGGACTCACACAAACTTAAGG - Intronic
1112068697 13:95823630-95823652 TAAGAATTCACATAAATTCAAGG - Intronic
1112087189 13:96043633-96043655 TAAGGACTCACATAAACTTAAGG + Intronic
1112155841 13:96816075-96816097 GAAGGCCTCACATATCCTGATGG + Intronic
1113240488 13:108331097-108331119 TAAGGACTCACATAAACTTAAGG + Intergenic
1113534840 13:111057693-111057715 TAAGGATTCACATAAATGTAAGG - Intergenic
1113637962 13:111934712-111934734 CGAGGACTCATATAAACTTAGGG - Intergenic
1113845436 13:113386681-113386703 TAAGGACTCACATAAACTTAAGG - Intergenic
1114030600 14:18576227-18576249 TAACGACTTACATAAACTTAAGG - Intergenic
1114337137 14:21701752-21701774 AAAAGACTCACATAAGCTTAAGG + Intergenic
1114756495 14:25266141-25266163 AAAAGATTCACATAAACTTAAGG - Intergenic
1114826428 14:26086322-26086344 TGAGGTCTCACAAAATCTGATGG - Intergenic
1115299460 14:31867438-31867460 TAAGGACTCACTTAAAGTAAAGG + Intergenic
1115350442 14:32389214-32389236 TAAGGACTCGCACAAACTTAAGG - Intronic
1115393029 14:32875514-32875536 AAAGGACTCACATAAACTTAAGG - Intergenic
1115835292 14:37395882-37395904 TAAGGACTCACATAAAGGAAAGG - Intronic
1115937922 14:38576063-38576085 TAGCGACTCACATAAACTTAAGG - Intergenic
1115947836 14:38683420-38683442 TAAGGATTCATATAAACTCAAGG - Intergenic
1115965638 14:38884597-38884619 TAGGGACTGTTATAAACTGAAGG + Intergenic
1116076452 14:40117348-40117370 TAAGGATTCATAAAAACTCAAGG - Intergenic
1116324611 14:43516312-43516334 TAAGGACTCACATAAACATAAGG + Intergenic
1116335699 14:43653399-43653421 TAAAGACTCACACAAACTTAGGG + Intergenic
1116668853 14:47815529-47815551 TAAGGACCCACATAAACTGAAGG - Intergenic
1116695202 14:48166468-48166490 TAAGGATTCATATAAACTCAAGG + Intergenic
1116815918 14:49583555-49583577 TTAGAACACTCATAAACTGAAGG + Intronic
1117112961 14:52477441-52477463 TAAAGACTCACATAAACTTAAGG + Intronic
1117182402 14:53204459-53204481 TAAGGAATTACATAAACTTAAGG + Intergenic
1117193242 14:53314586-53314608 TAAGGACTCACATAAACTTAAGG - Intergenic
1117240909 14:53831466-53831488 TAAAGACTCACATAAACTCAAGG + Intergenic
1117271557 14:54148840-54148862 AAGAGACTCACATAAACTTAAGG + Intergenic
1117655231 14:57949401-57949423 TATGAACTCCCATAAACTTAAGG - Intronic
1117768725 14:59109948-59109970 TAAGGACTTGCAAAAACTTAAGG + Intergenic
1118165780 14:63334402-63334424 TAAGAACTCACATAAACTTAAGG + Intergenic
1118168247 14:63359074-63359096 CAAGGATACAGATAAACTGAAGG + Intergenic
1118421029 14:65603873-65603895 TAAGGATTGACATAAACTTAAGG + Intronic
1119453614 14:74735015-74735037 TAAGGAATCAGAGAGACTGATGG + Exonic
1119852118 14:77873671-77873693 TTAGTTCTCACATAATCTGATGG + Intronic
1120400150 14:84021142-84021164 CAAGGGCTCAAATAAACTTAAGG - Intergenic
1120450739 14:84664098-84664120 TAAAGACTCACATAAACTTAAGG - Intergenic
1120736165 14:88055620-88055642 TAAGGACTCACATAAACTTAAGG - Intergenic
1120785467 14:88530554-88530576 TAAGAACTCACATAAACTTAAGG + Intronic
1121475841 14:94201690-94201712 TAAGGACTCACATAAACTTAAGG - Intronic
1121503275 14:94456893-94456915 CAAGGACTCACATAAATGTAAGG - Intergenic
1121725648 14:96147253-96147275 TAAGGACTCACATAAGCTTAAGG - Intergenic
1121848247 14:97194611-97194633 TCAGGACTCACCTAAACTTAAGG - Intergenic
1124505309 15:30267484-30267506 TAAGCACTCACATAAACTTAAGG + Intergenic
1124738243 15:32271147-32271169 TAAGCACTCACATAAACTTAAGG - Intergenic
1125145647 15:36464918-36464940 TAAGGATTCTTATAAACTCAAGG - Intergenic
1125247289 15:37654966-37654988 TAAGGACTCATATAAGCTTAAGG + Intergenic
1126184459 15:45818390-45818412 CAAGGACTCACGTACACTTAAGG - Intergenic
1126190752 15:45875580-45875602 ATAGGACTCACATACACTTAAGG + Intergenic
1126521239 15:49596740-49596762 TAAAGACTCACATAAACTTAAGG + Intronic
1126521461 15:49600279-49600301 TAAGGACACACATAGACTGAAGG - Intronic
1126566122 15:50101358-50101380 TAAAGACTCACATAAACTTAAGG + Intronic
1126997240 15:54458770-54458792 GAAGGATACACATAAACTTAAGG - Intronic
1127194664 15:56570669-56570691 TAAGGACTCACATAAGCTTAAGG + Intergenic
1127573765 15:60270536-60270558 TAAGGACTCATATAAACTTATGG - Intergenic
1127694478 15:61431632-61431654 TAAGCGTTCACATAAACTTAAGG - Intergenic
1129562646 15:76588467-76588489 TAAGGACTCACATAAACTTAAGG - Intronic
1130290628 15:82597300-82597322 TAAGGAATCAGAGAGACTGATGG + Intronic
1130749566 15:86696454-86696476 TAAGGACTCATATAGACTTAAGG - Intronic
1131632767 15:94196483-94196505 AAAGAAATCACATAAACTGGAGG - Intergenic
1132173301 15:99686102-99686124 TAAGGACTCACATAAAGTAAAGG - Intronic
1132253909 15:100357379-100357401 TAAGGACTCACATAAACTTAAGG + Intergenic
1132459093 16:41460-41482 TAAGGAATCAGAGAGACTGATGG - Intergenic
1133245029 16:4442967-4442989 TAAGTACGCAGGTAAACTGATGG - Intronic
1133952940 16:10413033-10413055 TAAGGGCTCACATAAGCTTAAGG - Intronic
1134805817 16:17124006-17124028 TGAGGACTCACATGAACTTAAGG - Intronic
1135203043 16:20455917-20455939 CAAGAACTCACATAAACTTAAGG + Intronic
1135216056 16:20571944-20571966 CAAGAACTCACATAAACTTAAGG - Intronic
1136735779 16:32466090-32466112 TAACAACTTACATAAACTTAAGG - Intergenic
1138192311 16:55024076-55024098 TAAGGACTCACATAAACTTAAGG + Intergenic
1139024197 16:62793960-62793982 GAAGGATTCATATAAACTCAAGG - Intergenic
1140531007 16:75666050-75666072 TAAGAACTCACATAAACTTAAGG + Intronic
1140548115 16:75832021-75832043 TAAGGACTCACATAAACTTAAGG - Intergenic
1141566990 16:84909291-84909313 AAAGCACACACATAAACTGCGGG - Exonic
1203017296 16_KI270728v1_random:363484-363506 TAACAACTTACATAAACTTAAGG + Intergenic
1203035631 16_KI270728v1_random:636642-636664 TAACAACTTACATAAACTTAAGG + Intergenic
1142910590 17:3087373-3087395 TAAGGACTCACATAAACTTAAGG - Intergenic
1142940131 17:3373666-3373688 TAAGGACTCATGGAAACTTAAGG - Intergenic
1143356487 17:6332864-6332886 AAAGGACTTCCATAAACTGCAGG - Intergenic
1144616275 17:16776975-16776997 TACGGACTCACATAAACTTAAGG + Intronic
1144896428 17:18538684-18538706 TACGGACTCACATAAACTTAAGG - Intergenic
1145135789 17:20405533-20405555 TACGGACTCACATAAACTTAAGG + Intergenic
1146742121 17:35295807-35295829 TAAGGACTCAGCAGAACTGAAGG - Intergenic
1146746455 17:35334508-35334530 TAAGGACTCACAAAAACTTAAGG - Intergenic
1147342075 17:39758650-39758672 TGAGGACTCACAGACAGTGAGGG + Intergenic
1147809015 17:43153669-43153691 TAAGGAATCAGAGAGACTGATGG - Intergenic
1149068859 17:52515784-52515806 TAAGCCCTCACAGCAACTGAAGG + Intergenic
1149221589 17:54420450-54420472 TAAGGACTCACATAAACTTAAGG + Intergenic
1150016453 17:61562283-61562305 GAAGCACACACATATACTGAAGG - Intergenic
1150896089 17:69212821-69212843 TAAGGACTCACATAAACTTAAGG - Intronic
1150945692 17:69743333-69743355 TCAGCTCCCACATAAACTGAAGG + Intergenic
1151048586 17:70949737-70949759 TAAGGACTCACATAAAGTAAAGG + Intergenic
1151079008 17:71306709-71306731 TAAGGACTCACATAAACTTAAGG + Intergenic
1152953911 18:19412-19434 TAACGACTTACATAAACTTAAGG + Intergenic
1153071738 18:1114070-1114092 TAAGGGCTCACACAAACTTAAGG - Intergenic
1153079716 18:1208600-1208622 TAAAGACTCACATAAACTTAAGG - Intergenic
1153164470 18:2246224-2246246 TAAGAACTCACATAAACTTAAGG + Intergenic
1153425239 18:4955654-4955676 TAAGGTCTCACATAAACTTAAGG + Intergenic
1153532795 18:6066730-6066752 TAAGGAGTCACATAAACTTAAGG - Intronic
1153828957 18:8902945-8902967 TAAGGAGACACATATACTTAAGG + Intergenic
1154090196 18:11351344-11351366 TAAGGACTCACATAAACTTAAGG + Intergenic
1154298074 18:13167805-13167827 TAAGGACTCACAAAAATTTAAGG + Intergenic
1154498657 18:14981490-14981512 TAACGACTTACATAAACTTAAGG + Intergenic
1155286981 18:24299100-24299122 TAAGGATTCATATAAACTCAAGG - Intronic
1155386626 18:25285025-25285047 TAAGGACTTAGCTAAGCTGAAGG + Intronic
1156011124 18:32499236-32499258 TGAGGACTCACATAAAGTAAAGG - Intergenic
1156326859 18:36081726-36081748 TAAGAACTCACATAAACTTAAGG + Intergenic
1156606937 18:38677975-38677997 TAAGGTCTCAAGTAAACTTAAGG - Intergenic
1156642705 18:39121484-39121506 TAAGGACTCACATAAACTTCAGG + Intergenic
1156643183 18:39126736-39126758 TACGGACTCACAGAAATTTAAGG + Intergenic
1156667673 18:39427525-39427547 TAAGGACTCATATAAACTTAAGG + Intergenic
1156893172 18:42213627-42213649 TTAAGACTCACATAAACTTAAGG - Intergenic
1157218788 18:45809006-45809028 TAAGGACTCACATAAACTTAAGG + Intergenic
1157507697 18:48240967-48240989 TAAGGACTCACATAGACTTAAGG + Intronic
1157691835 18:49689384-49689406 AAAGAACTCTCAAAAACTGAAGG + Intergenic
1157703093 18:49777412-49777434 TAAAGACTCACATGAACTTAAGG - Intergenic
1158735828 18:60077637-60077659 TAAAGACTCATATAGACTAAAGG + Intergenic
1159073718 18:63656648-63656670 TAGGGCCTGACACAAACTGAAGG - Intronic
1159453848 18:68636780-68636802 TAAGGACTCATATACACTTAAGG - Intergenic
1159612679 18:70544161-70544183 TAAGGACTCACAAAAACTTAAGG - Intergenic
1159906791 18:74099683-74099705 TAAGGACTCACATAAACTTAAGG + Intronic
1159986985 18:74854225-74854247 TTAGGACTTCCATAAACTGCTGG - Intronic
1160059026 18:75512945-75512967 TAGAGACTCACATAAACTTAAGG + Intergenic
1163855660 19:19700117-19700139 TAAGGACTCACTTAAACTTAAGG - Intergenic
1163871659 19:19826307-19826329 TAAGGACTCACTTAAACTTAAGG + Intergenic
1163886368 19:19968795-19968817 TAACGACTCACTTAAACTTAAGG - Intergenic
1163897253 19:20069959-20069981 TAAAGACTCACATAAACTTAAGG + Intergenic
1163907971 19:20163692-20163714 TAAAAACTCACATAAAGTTAAGG + Intergenic
1163949910 19:20574372-20574394 TAAGGACTCACATAAACTTAAGG - Intronic
1163968094 19:20767015-20767037 TAAGGACTAACATAAACTTAAGG + Intronic
1164054702 19:21612618-21612640 TAAGGAATCAGAGATACTGAGGG - Intergenic
1164251958 19:23485275-23485297 TAAAGACTCAAATAAAGTAAAGG + Intergenic
1164267616 19:23634753-23634775 TAAGGACTCGCAAAAACTTAAGG + Intronic
1164273602 19:23697091-23697113 TAAAAACTCAAATAAACTTAAGG - Intergenic
1164422606 19:28108637-28108659 TCAGGATTCATATAAACTCAAGG + Intergenic
1164697408 19:30256159-30256181 TAAGGCCCCACAGAAACTTAAGG + Intronic
1165197854 19:34119473-34119495 TAAAGTGTCACGTAAACTGATGG - Intergenic
1166262928 19:41654676-41654698 CAAGGACTCACATAAACTTAAGG + Intronic
1166450302 19:42893567-42893589 TAAAGTGTCACATAAACTTAAGG - Intronic
1166899874 19:46051753-46051775 CAAGGACTCACATAAACTTAAGG + Intronic
1166972659 19:46580105-46580127 CAAGGTCACACATAAACTGGAGG + Intronic
1167219976 19:48192843-48192865 TAAGGAATCAGAGAGACTGATGG - Intronic
1167290393 19:48621576-48621598 TTAGGAATCAGAGAAACTGAGGG + Intronic
1168395883 19:56048088-56048110 TAAAGACTCACATAAAGTAAAGG - Intronic
925127266 2:1468060-1468082 TAAGGACTCACATAAACTTAAGG - Intronic
925441724 2:3893482-3893504 TAAGGATTCACATAAATGTAAGG - Intergenic
925705726 2:6683328-6683350 GAAGGACTCCCATAAATTTAAGG + Intergenic
925795503 2:7537852-7537874 CAAGCACCCACATAAACTTAAGG - Intergenic
926235323 2:11038489-11038511 TAAGGATTCATAAAAACTCAAGG - Intergenic
926501648 2:13661591-13661613 TAATGACACACATAAGCTCAAGG - Intergenic
926866797 2:17368862-17368884 TAAGGACTCACATAAACTTCAGG - Intergenic
927036527 2:19183328-19183350 TAAAGACTCACATAAACTTAAGG - Intergenic
927069756 2:19515330-19515352 TAAGGACTAACATTCACTTAAGG - Intergenic
927176534 2:20413172-20413194 TAAAGACTCACATAAACTTAAGG - Intergenic
927363299 2:22262974-22262996 TAAGGACTCACATAAACTTAAGG - Intergenic
928235547 2:29536291-29536313 TAAGAACTCACATATACCAAGGG - Intronic
928356891 2:30624386-30624408 TAAGGACTCACATAAACTTAAGG + Intronic
928479941 2:31673019-31673041 TAAGAATTCATATAAACTCAAGG - Intergenic
928685195 2:33742552-33742574 TAGGGACTCACATATACTTAAGG - Intergenic
928782880 2:34846712-34846734 TAAGTACTCACATAAACTTAAGG - Intergenic
928798672 2:35058480-35058502 TAATGACTCACATAAACTTAAGG - Intergenic
928856165 2:35804933-35804955 TAAGGACTCACATAAAGTAAAGG + Intergenic
928862305 2:35874176-35874198 TAAGTTCTCACAAAATCTGATGG - Intergenic
928988663 2:37206920-37206942 TAAGGACTCACATAAACTTAAGG + Intronic
929010083 2:37433243-37433265 TAAGGACTCACATAAACTTAAGG - Intergenic
929398896 2:41556674-41556696 TAAGGACACACATAAACTTAAGG + Intergenic
929963595 2:46515801-46515823 TAAGGACACACACAGGCTGAGGG + Intronic
930423270 2:51179837-51179859 TAAGGACTCACATAAACTTAAGG + Intergenic
930486310 2:52015964-52015986 TAAGGACTCACATAAAGTAAAGG - Intergenic
930574113 2:53125468-53125490 TAGGGACTCATATAAACTTAAGG - Intergenic
931136176 2:59403918-59403940 TAAGGACTCACACAAACTTAAGG + Intergenic
931136809 2:59412384-59412406 TAAGGACTCACACAAATTTAAGG - Intergenic
931176582 2:59860829-59860851 TAAGTTCTCACAAGAACTGATGG - Intergenic
931536008 2:63277521-63277543 TAAGGACTCCCATAAATTTAAGG + Intronic
931834823 2:66087543-66087565 TAAGGACTCATATAAATTTAAGG + Intergenic
932533776 2:72568982-72569004 TTAGGACTCACATCAACTCAAGG - Intronic
932925655 2:75970709-75970731 TAAGGACTCACATAAACATAAGG + Intergenic
933086128 2:78056589-78056611 TAAGCACTCACATAAACTTAAGG - Intergenic
933110956 2:78399372-78399394 TAAAGACTCACATAAAATTAAGG + Intergenic
933382214 2:81563255-81563277 TAAGGACTCACATAAAGTAAAGG - Intergenic
933398113 2:81757080-81757102 TAAGGACTCACATACAATTAAGG + Intergenic
933425721 2:82109789-82109811 TAAGTTCTCACAAGAACTGATGG - Intergenic
933433283 2:82212920-82212942 TAAGGAATCACATAAACTTAAGG - Intergenic
933627362 2:84616562-84616584 TAAGGAATCACATAAACTTAAGG - Intronic
934177552 2:89589692-89589714 TAATGACTTACATAAACTTAAGG - Intergenic
934186947 2:89755198-89755220 TAACAACTTACATAAACTTAAGG - Intergenic
934287849 2:91663994-91664016 TAATGACTTACATAAACTTAAGG - Intergenic
934310042 2:91853973-91853995 TAACAACTTACATAAACTTAAGG + Intergenic
935000775 2:99012452-99012474 TAAGGACTCACATAAACTTAAGG + Intronic
935007308 2:99091571-99091593 TAAGAATCCACATAAACTTAAGG + Intronic
935610257 2:105015666-105015688 TAAGGACTCACATAAACTTAAGG - Intergenic
936141080 2:109941010-109941032 TAAGGACTCACATAAATTTAAGG + Intergenic
936177768 2:110238955-110238977 TAAGGACTCACATAAATTTAAGG + Intergenic
936203613 2:110430476-110430498 TAAGGACTCACATAAATTTAAGG - Intronic
936555103 2:113489631-113489653 TAAGGACTCACATAAACTTAAGG + Intronic
936701846 2:115020277-115020299 TAAGGACTCACATAAACTTTAGG + Intronic
936879208 2:117229997-117230019 GAAGGATTCATATAAACTCAAGG - Intergenic
936884880 2:117298800-117298822 TAAGGATTCTCTTAAACTCAGGG - Intergenic
936899115 2:117464300-117464322 TAAAGACTCACATGAACTTAAGG - Intergenic
936910961 2:117593200-117593222 TAAGAGCTCACATAAACTTAAGG - Intergenic
937461322 2:122089888-122089910 TACGGACTCACATAAACTTTAGG - Intergenic
937480501 2:122253426-122253448 TAAGGACTTACATAAACTTAAGG + Intergenic
937572641 2:123382795-123382817 TAAAGACTCACATAAACTTAAGG + Intergenic
937663210 2:124454168-124454190 TAAGAACTCACATAAACTTAAGG + Intronic
937716141 2:125035688-125035710 TAAGGACTCACAAAAACTTAAGG - Intergenic
937722869 2:125124432-125124454 TAAAAATTCACATAAACTTAAGG - Intergenic
937791212 2:125964043-125964065 TAAGGTCGTACAGAAACTGAGGG + Intergenic
937798799 2:126057411-126057433 TTACGACTCACATGAACTTAGGG - Intergenic
937828769 2:126397551-126397573 TAAGGACTCATATAAACTTAAGG - Intergenic
938175397 2:129122213-129122235 TAAAGACTCACATAAACTTAAGG - Intergenic
938216354 2:129520705-129520727 TAAGGAGTTACATAAACTTAAGG - Intergenic
938497610 2:131809540-131809562 TAACGACTTACATAAACTTAAGG + Intergenic
938564063 2:132501949-132501971 TAAGTACTCACATCAACTTAAGG - Intronic
938599629 2:132823825-132823847 TAAGGACTCACATAAACCTAAGG + Intronic
938674740 2:133620389-133620411 TAAGGACTCACATACACTTAAGG + Intergenic
938853907 2:135290468-135290490 TAAGGATTCACATAAACTTAAGG - Intronic
939219524 2:139283541-139283563 TAAGCACTAACATAAACTTAAGG + Intergenic
939240030 2:139546524-139546546 TAAGGACTCACCTAAACTTAAGG - Intergenic
939245578 2:139619420-139619442 TAAGGACTCACATAAACATCAGG - Intergenic
939449401 2:142353623-142353645 TAAGAACTCACATAACCTTAAGG + Intergenic
939919329 2:148088972-148088994 TAAGGACTCATATAAACTTGAGG + Intronic
940217818 2:151318247-151318269 GAAGTATTCACATAAACTTAAGG + Intergenic
940384690 2:153057358-153057380 TAAGAACTCATGTAAACTTAAGG - Intergenic
940423505 2:153506214-153506236 TAAAGACTCACGTAAACCTAAGG - Intergenic
940630511 2:156231977-156231999 TAGGGACTCACATAAACTTAAGG + Intergenic
940762549 2:157753080-157753102 TAAGGACTCAAATAAACTTAAGG + Intronic
940784789 2:157969843-157969865 AAAGGACTCACGTAAACTTAAGG - Intronic
940796620 2:158087361-158087383 TAAGGACTCACATAAACTTAAGG - Intronic
941060860 2:160845016-160845038 TAGGGACTCACATAAACTTAAGG + Intergenic
941358171 2:164517633-164517655 TAGGGACTCACATAAACTTAAGG + Intronic
941402014 2:165042884-165042906 TAAGGACTCACATAAACTTAAGG - Intergenic
941627640 2:167846879-167846901 TAAGGACTCACATAAAGTAAAGG + Intergenic
941679818 2:168385356-168385378 AAAGGACTCACATAAACTTAAGG + Intergenic
941702306 2:168616503-168616525 TAAGGACTCACATAAACTTAAGG + Intronic
941825107 2:169886249-169886271 CAGGGAATCACATAAACTGTTGG + Intronic
942154531 2:173114256-173114278 TAAGTACTCACATAAAGTAAAGG - Intronic
942743819 2:179208991-179209013 TAAGGACTCACATAAACTTAAGG + Intronic
943128003 2:183820488-183820510 TAAGGACTCATATAAATTTAAGG - Intergenic
943130535 2:183848274-183848296 TAAGGACTCACACAAACTTAAGG + Intergenic
943149738 2:184097293-184097315 TAAGGACTCACATAAACTTAAGG - Intergenic
943199000 2:184794773-184794795 TAAGGATGCATATAAACTTAAGG + Intronic
943607666 2:189995487-189995509 TAAGGACTCATGTAAACTTAAGG - Intronic
943654483 2:190493149-190493171 TAGGAACTCACATAAATTTAAGG + Intronic
943909488 2:193544511-193544533 TAAGGACTCATATAAACTTAAGG + Intergenic
943943699 2:194031093-194031115 TGAGGACTCAAATAAACTTAAGG + Intergenic
944303356 2:198150613-198150635 TAAGCACTCTCATAAACTCCTGG - Intronic
944431838 2:199642549-199642571 AAAGGACTCGCACAAACTTAAGG - Intergenic
944603183 2:201324126-201324148 AAAGGATTCAAATAAACTCAAGG + Intronic
945285887 2:208081064-208081086 TAAGGACTCAGATAAACTTACGG + Intergenic
945337976 2:208615577-208615599 TAAGGACTCACATAAACTTAAGG - Intronic
945377187 2:209092798-209092820 TAAAGACTCAAGTAAACTTAAGG - Intergenic
945387210 2:209216713-209216735 TAAGGACTCACATAAACTTAAGG + Intergenic
945536363 2:211023237-211023259 TAAGGAATCACAAAAACTTAAGG - Intergenic
945655866 2:212622970-212622992 TAAGGACGCATATAAATTGAAGG + Intergenic
945739071 2:213639113-213639135 TAAGGACTCATATAAACTTAAGG - Intronic
946036671 2:216748108-216748130 TAAGGACTCACATAAAGTAAAGG + Intergenic
946563201 2:220936296-220936318 TACTGACTCACAAACACTGAAGG + Intergenic
947460692 2:230301899-230301921 TAAGGACTCACATAAACTTAAGG + Intronic
948240427 2:236428606-236428628 TAAGGACACATATAGAATGAAGG - Intronic
948531389 2:238608526-238608548 TAAGGACTCACATAAACTTAAGG + Intergenic
948576922 2:238958417-238958439 TAAGGACTCAGAAAAACTTAAGG + Intergenic
948774463 2:240276037-240276059 TAAGTTCTCACAAAATCTGATGG + Intergenic
1169011816 20:2257364-2257386 TAAGGAATCAGAGAGACTGAGGG - Intergenic
1169397721 20:5249194-5249216 TAAGGACTCACATAAACTTAAGG - Intergenic
1169996884 20:11567854-11567876 AAAGGAGACACATAGACTGATGG - Intergenic
1170086425 20:12537420-12537442 CAAGGACTCACATAAACTTAAGG + Intergenic
1170124998 20:12952995-12953017 TAAGGACTCACATTAACTTAAGG - Intergenic
1170241523 20:14172209-14172231 AAAGGACTCACATAAACTTAAGG - Intronic
1170489280 20:16855615-16855637 TGACAACTCACATAAACTTAAGG - Intergenic
1170650989 20:18241179-18241201 TGAGAACTCACATAAACCTAAGG + Intergenic
1170726724 20:18935330-18935352 TGACAACTCACATAAACTTAAGG - Intergenic
1170741243 20:19058698-19058720 TAAGGACTCACATAAACTTAAGG + Intergenic
1171027980 20:21649791-21649813 TAAGGACTTGCACAAACTTAAGG + Intergenic
1171038496 20:21737797-21737819 TAAGGACTCACATAAACTTAAGG - Intergenic
1171066761 20:22024842-22024864 TAAGGACTCACATAAACTTAAGG - Intergenic
1171080381 20:22176257-22176279 TAAGAACTCACATAAACTTAAGG - Intergenic
1171242100 20:23579455-23579477 TAAGGACTTAAACAAACTTAAGG - Intergenic
1172586796 20:36091375-36091397 CAAGGACTTACACAAACTAAGGG - Intergenic
1172851235 20:37967302-37967324 TAAGGTCTCACATAAACTTAAGG - Intergenic
1173568546 20:44060023-44060045 TAAGGACACACATAACCTTTAGG + Intronic
1173769137 20:45642793-45642815 TAAGGACACACATAGACTGAAGG - Intergenic
1174898306 20:54473795-54473817 TAATTACTGACAAAAACTGAAGG - Intergenic
1176365623 21:6030957-6030979 TAAGGAATCAGAGAAACTGATGG + Intergenic
1176711738 21:10155868-10155890 TAAGGAATCAGAGAGACTGATGG - Intergenic
1176906281 21:14505365-14505387 TAAAGACTCACACAAACTTAAGG + Intronic
1176992591 21:15516529-15516551 TATAAACTCACAAAAACTGATGG - Intergenic
1177069421 21:16484840-16484862 TAAGGACTCACATAAACTTTAGG - Intergenic
1177124477 21:17179103-17179125 AAAGGATTTACATAAACTTAAGG + Intergenic
1177330896 21:19660748-19660770 TAAGGACTCACATAAACTTAAGG + Intergenic
1177661381 21:24087751-24087773 TAAGGACTCACATAAGGTAAAGG + Intergenic
1177681199 21:24373756-24373778 TAAGGACGCAAATAAACTTAAGG - Intergenic
1177749857 21:25267329-25267351 CAAGGACTCACATAAACTTAAGG + Intergenic
1177934948 21:27333549-27333571 TAAGGACTCACATAAACTTAAGG + Intergenic
1177995156 21:28088149-28088171 TAAGGACTCACATAAAGTAAAGG - Intergenic
1178038389 21:28610665-28610687 TAAGGACTCACACAAACTTAAGG + Intergenic
1178659756 21:34497034-34497056 TAAGGACTCACATAAACTTAAGG - Intergenic
1178733058 21:35122575-35122597 TAAGGACTCACATAAACTTAAGG + Intronic
1179260472 21:39753854-39753876 TAAGCACTCACATAAACTCAAGG - Intronic
1179467575 21:41587296-41587318 TAAGGACTCACATAAACTTAAGG - Intergenic
1179757895 21:43507588-43507610 TAAGGAATCAGAGAAACTGATGG - Intergenic
1180040071 21:45272177-45272199 TAAGGACTCACACAAACTTAAGG + Intronic
1180454714 22:15503283-15503305 TAACGACTTACATAAACTTAAGG - Intergenic
1180536779 22:16399854-16399876 TAACAACTTACATAAACTTAAGG + Intergenic
1180896573 22:19338584-19338606 TATGGACTCACATAAGTTGAGGG + Intronic
1181077030 22:20386577-20386599 TAGGAACTCTCATATACTGATGG + Intronic
1181337605 22:22151983-22152005 TAAGGAATCAGAGAGACTGATGG + Intergenic
1182199025 22:28550826-28550848 CAAGGACTCATATAAACTTAAGG + Intronic
1182682824 22:32095724-32095746 TAAGGACTCACATAAATTTAAGG - Intronic
1184063793 22:42103289-42103311 TAGGGACTCACATAAACTTAAGG - Intergenic
949145851 3:699238-699260 TAAGGACTCACATAAACTTAAGG - Intergenic
949377535 3:3407024-3407046 TAAGGACTCACATAAGCTTCAGG + Intergenic
949687791 3:6597480-6597502 TAAGGATACACATAGACTGAAGG - Intergenic
949749514 3:7334687-7334709 TAAGGACTCACATAAACTTAAGG + Intronic
949799363 3:7886183-7886205 TAAAGGCTCACAAAAACTTAAGG + Intergenic
950588086 3:13910964-13910986 TAAGGATTTACATAAACTTAAGG + Intergenic
950595177 3:13973818-13973840 GAAGGATTCATATAAACTCAAGG - Intronic
950599021 3:14015296-14015318 TAAGGACTCACATAAACTTAAGG - Intronic
950603213 3:14054603-14054625 TTAGGATTCACATAAAGTAAAGG - Intronic
951153543 3:19322060-19322082 TCAGGACTCATGTAAACTTAGGG - Intronic
951260471 3:20502086-20502108 TAAGGACTCAAATAAACTTAAGG - Intergenic
951262045 3:20521826-20521848 TAAGGACTCACATAAACTTAAGG - Intergenic
951268269 3:20595819-20595841 TAAGTGTTCACATAAACTTAAGG - Intergenic
951294684 3:20919429-20919451 TAAGAATTCACATGAACTTAAGG + Intergenic
951600857 3:24373222-24373244 TACTGGCTCTCATAAACTGAAGG + Intronic
951690825 3:25394772-25394794 TAAAGACTCACATAAACTTAAGG - Intronic
951727103 3:25772512-25772534 TAAAGACTAACATAAACTTAAGG - Intronic
951764046 3:26177342-26177364 TAAAAACTCACATAAACTTAAGG - Intergenic
952054957 3:29433162-29433184 TAAGGAATAATATAATCTGAGGG - Intronic
952083069 3:29783814-29783836 TAAGGCCTCACATAAACTTAAGG + Intronic
952183045 3:30939643-30939665 TAAGGACTCACATAAACTTAAGG - Intergenic
952265275 3:31779335-31779357 TAAGGGCTGACATAAACTCAAGG + Intronic
952402158 3:32973197-32973219 TAAGGAATCAGAGAGACTGATGG - Intergenic
952601698 3:35090849-35090871 TAAGGACTCATATAAACTTAAGG + Intergenic
952689658 3:36190326-36190348 CAAGGACTCACACAAACTTAAGG - Intergenic
952714728 3:36468961-36468983 TAAGGACTCACATAAACTTAAGG - Intronic
952732681 3:36655240-36655262 CAAGAACTCACATAAATTTAAGG + Intergenic
952984650 3:38768111-38768133 TAAGGAGCCACATAAACTTAAGG - Intronic
952993905 3:38858286-38858308 TAAGGACTCATATAAACTTAAGG + Intronic
953185474 3:40633595-40633617 TAAGGACTCACATAAACTTAAGG + Intergenic
953382389 3:42482208-42482230 TAAGGACTCACATAAACTTAAGG + Intergenic
953495339 3:43381335-43381357 TAAGAACTCACATAAACTTAAGG + Intronic
953639341 3:44691215-44691237 TAAGGACTCACATAAACTTAAGG + Intergenic
954479999 3:50790177-50790199 TAAGGACTCATATAAACTTAAGG - Intronic
955446007 3:59010326-59010348 TAAGGACTCACATAAACTTTGGG + Intronic
955450560 3:59062716-59062738 TAATGACTGACATAAACTTAAGG - Intergenic
957281657 3:78157740-78157762 GAAGGATTCATATAAACTCAAGG + Intergenic
957433124 3:80139428-80139450 TAAAGACTCACATAAACTTAAGG + Intergenic
957681554 3:83442035-83442057 TAAGGACTCACACAAATTTAAGG + Intergenic
957909374 3:86602634-86602656 TAAGTTCTCACAAAATCTGATGG + Intergenic
957921539 3:86755162-86755184 TAAGGATTTATATAAACTCAAGG - Intergenic
957971891 3:87392530-87392552 TAAAGACTCACATAAACTTAAGG + Intergenic
958064359 3:88524188-88524210 TAAGGACTCACATAAACTTAAGG - Intergenic
958152331 3:89705965-89705987 TAAGGACTTGCATAAACTTAAGG + Intergenic
958509919 3:95035087-95035109 TAGGAACTCACATAAACTTAAGG - Intergenic
958768532 3:98399149-98399171 TAAGGATTCATATAAACTCAAGG + Intergenic
958775441 3:98477586-98477608 TAAGGACTCACATAAACTTAAGG - Intergenic
958787173 3:98610897-98610919 TAAGGACTCACATAAACTTAAGG - Intergenic
958790010 3:98641578-98641600 TAAGGACTCATATAAACTTAAGG - Intergenic
958818847 3:98949640-98949662 TCAGAACTCACATAAACTTAAGG - Intergenic
959047162 3:101486885-101486907 TAAGGAATCACATAAACTTAAGG + Intronic
959125714 3:102288545-102288567 TAAGGACTTAAATAGACTTAAGG - Intronic
959424011 3:106163524-106163546 GAAGGACTCACATAAACTTAAGG + Intergenic
959464086 3:106664620-106664642 TAGGGACATACATAGACTGAAGG + Intergenic
959666338 3:108926298-108926320 TAAGGACTCACATAAACTTAAGG - Intronic
959715541 3:109429342-109429364 TAAGGACTCACATAAACTTAAGG - Intergenic
959727179 3:109557697-109557719 TAAGGACTTATATAAACTCAAGG - Intergenic
959875345 3:111375464-111375486 TAAAGACTCACATAAACTTAAGG + Intronic
959877993 3:111408783-111408805 TAAGAACTCACATAAACTTAAGG + Intronic
960152879 3:114269004-114269026 TAAGGACTCACATAAACTTAAGG - Intergenic
960379468 3:116941518-116941540 TAAGGATTCATATAAACTCAAGG + Intronic
960516728 3:118610085-118610107 TAAGGACTCACATAAACTTAAGG + Intergenic
960558079 3:119051240-119051262 TATGGGCTCACATAAACTTAAGG + Intronic
960578309 3:119248897-119248919 TAGGGACTCACATAAACTTAAGG + Intergenic
960712147 3:120542164-120542186 TAAGGATTCACATAAACTTAAGG - Intergenic
960761834 3:121080196-121080218 TAAGGACTCACATAAACTTAAGG - Intronic
960769900 3:121181823-121181845 TAAGGACTCACATAAACTTCAGG + Intronic
960778425 3:121289124-121289146 TAAGGACTCACATAAACTTAAGG + Intronic
961407368 3:126690510-126690532 TAAGAACTCACATAAGTTTAAGG + Intergenic
961967757 3:130923941-130923963 GAAGGACTCACATAAGATAAAGG - Intronic
961977902 3:131045979-131046001 TAAGAACTCATGTAAACTTAAGG - Intronic
962013104 3:131412638-131412660 GAAGGACTCACATAAACTTAAGG + Intergenic
962034634 3:131638309-131638331 GAAGGACTCACATAAACTTAAGG + Intronic
962147234 3:132853421-132853443 GAAGGACTCACATCAACTTAAGG - Intergenic
962192078 3:133321284-133321306 TAAGGACTCACAGAAACTTAAGG + Intronic
962503177 3:136016685-136016707 TAAGGACTCACAGAGACTTAAGG - Intronic
962504751 3:136035087-136035109 TAAGGACTTGCACAAACTTAAGG - Intronic
962530282 3:136274000-136274022 TAAGGATTCATATAACCTCAAGG - Intronic
962709620 3:138074920-138074942 TTAGGACTCACACAAACTTAAGG + Intronic
962861982 3:139412589-139412611 TAAGGACTCATATAAACTTAAGG - Intergenic
962999581 3:140665983-140666005 AAAGGACTCACATAAACTTAAGG + Intergenic
963023403 3:140895220-140895242 TAAGGACTCACATAAACTTGAGG - Intergenic
963050955 3:141143233-141143255 CAAGAACTCACATAAACTTAAGG - Intronic
963176282 3:142300807-142300829 CAAGGACTTACATAAACTTAAGG + Intergenic
963213407 3:142718997-142719019 TAAGGATTTGCATAAACTTAAGG + Intergenic
963373684 3:144436275-144436297 CAAGGACTCACGTAAACTTAAGG - Intergenic
963455805 3:145545597-145545619 TAAGGATTCACATCAATTCAAGG - Intergenic
963455841 3:145546297-145546319 TAAGGAATCAGAGAGACTGAGGG + Intergenic
963522326 3:146371179-146371201 TAAGGACTCACATAAACCTAAGG - Intergenic
963623154 3:147637143-147637165 TAAGGACTTACATAAACTTAAGG + Intergenic
963832660 3:150024831-150024853 TAAGGACTCATATAAACTTAAGG + Intronic
964017673 3:151966861-151966883 CAAAGACTCACATAAACTTAAGG + Intergenic
964075850 3:152690556-152690578 TAAAGACTCACATAAACTTAAGG + Intergenic
964252944 3:154741151-154741173 TGAGTACTCACATAAACTTAAGG + Intergenic
964331794 3:155610982-155611004 TAAGGACACATGTAAACTTAAGG + Intronic
964342677 3:155724614-155724636 GAACGACTCACATAAACTTAAGG - Intronic
964393556 3:156222194-156222216 TGAGGACTCACGTAAACTTAAGG + Intronic
964644037 3:158938742-158938764 TAAGGAGTCACATAAACTTAAGG + Intergenic
964772828 3:160242131-160242153 TAAGGACTCACATAAACTTAAGG + Intronic
964867674 3:161278871-161278893 CAAGGACTCACATAAACTTAAGG + Intergenic
965026902 3:163313734-163313756 AAATGACTCACATAAACTTAAGG + Intergenic
965101740 3:164307526-164307548 TAAGGACTCAAATAAGATTAAGG + Intergenic
965184752 3:165448390-165448412 TAAGGACTCATATAAACTTAAGG + Intergenic
965296431 3:166953368-166953390 TAAAGACTCACATAAACTTAAGG - Intergenic
965573386 3:170193365-170193387 TAAAGATTCAGATAAACTCAAGG + Intergenic
965874191 3:173297644-173297666 TAAGGACTCACACAAACTTAAGG - Intergenic
966092928 3:176161670-176161692 TAAAGACTCACATAAAGTTAAGG + Intergenic
966229727 3:177638938-177638960 TAAAGATTCACATAAACTTAAGG - Intergenic
966352827 3:179048940-179048962 TAAGGACTCACATAAACTTAAGG + Intronic
966553088 3:181227769-181227791 TAAGAACTCACATAAACTTAAGG - Intergenic
967651591 3:191992423-191992445 TAACGACTCACATAAACTTAAGG + Intergenic
967899779 3:194437798-194437820 TAAGTACTAAAATAAACTAAGGG + Intronic
968720793 4:2202312-2202334 TAAGGACTCACATACACTTAAGG + Intronic
968807278 4:2782825-2782847 TAAAGACTCACATAAACTTAAGG - Intergenic
968849802 4:3071408-3071430 AAAGGAATCACATAAAATGAAGG - Intergenic
969165463 4:5306512-5306534 CAAGGACACACATAAACTTAAGG - Intronic
969230969 4:5830922-5830944 TAAAGACTTACATAAATTCAGGG - Intronic
970215630 4:13757023-13757045 TAAGGACTCACATAAACTGCAGG - Intergenic
970283152 4:14480399-14480421 TAAGGACTCCCATAAACTTAAGG + Intergenic
970312261 4:14794932-14794954 TAAGGACGCACATAAACCTAAGG + Intergenic
970411954 4:15817579-15817601 TAATGACTGAAATAAACTAATGG - Intronic
970549107 4:17161789-17161811 TAATGACTCACATAAACCTAAGG - Intergenic
970785016 4:19784886-19784908 TGAGTTCTCACAAAAACTGATGG - Intergenic
970856421 4:20653695-20653717 TGAGGACTCACATAAACTTAAGG + Intergenic
971050220 4:22853678-22853700 TAAGGACTCACATAAACTTAAGG - Intergenic
971472079 4:27038182-27038204 CAAGGACTCACATAAACTTAAGG - Intergenic
971554775 4:28000310-28000332 TAAGGACTCACATATACTTAAGG - Intergenic
971601498 4:28596803-28596825 TAAGGTCTCACAAGATCTGATGG + Intergenic
971720734 4:30242666-30242688 TATGGACTAACATAAACTTAAGG - Intergenic
971721693 4:30253574-30253596 TATGGACTCATATAAACTCAAGG - Intergenic
971797467 4:31246546-31246568 TAAAGATACACATAGACTGAAGG + Intergenic
972018527 4:34278633-34278655 TAAGGATTCATATAGACTCAAGG - Intergenic
972097148 4:35362608-35362630 TAAAGACTCACATAAACTTAAGG - Intergenic
972826980 4:42769877-42769899 GAATAACTCACATAAACTTAAGG + Intergenic
972899586 4:43667077-43667099 TAAGGACTCACATAAAGTTAAGG - Intergenic
973037323 4:45422322-45422344 TAAGGACTCACATAAACTTAAGG - Intergenic
973091616 4:46144656-46144678 TAAGGATTCATATAAACTCAAGG - Intergenic
973342872 4:49024216-49024238 TAAGGACTCACCTAAACTTAAGG - Intronic
973675857 4:53262124-53262146 TAAGGACTCACATAAACTTAAGG - Intronic
973831316 4:54762691-54762713 TAAGGACTCCCACAAACTTAAGG - Intergenic
974165253 4:58192974-58192996 TAAGGACTTGCACAAACTTAAGG + Intergenic
974583285 4:63835314-63835336 TAAGCGCTCACATAAACTTAAGG - Intergenic
974604265 4:64130093-64130115 TAAGGGGTCACATAATCTGTGGG + Intergenic
974855138 4:67452381-67452403 TAAGCTCTCACAAGAACTGATGG + Intergenic
974857575 4:67478839-67478861 TAAGGATTCACATAAGCTTAGGG + Intronic
975186729 4:71411854-71411876 TAAGCACTTAGACAAACTGAGGG + Intronic
975204274 4:71626135-71626157 TAAAGAATCACATAAACTTAAGG + Intergenic
975229529 4:71915688-71915710 TAAGGAATCAGAGAGACTGAGGG + Intergenic
975243618 4:72092710-72092732 TAAGGACCCATATAAACTTAAGG - Intronic
975509967 4:75183162-75183184 TAAGGATTCACATAAACTTAAGG + Intergenic
975623424 4:76317249-76317271 CAAGGACTCACATAAACTTAAGG + Intronic
975790331 4:77942747-77942769 TAAGGACTCAAATCAACTTAAGG - Intronic
975944838 4:79693866-79693888 TAAAGACTCACATAAACTTAAGG - Intergenic
975951211 4:79773608-79773630 TAAGTACTTGCATAAACTTAAGG + Intergenic
976157219 4:82159275-82159297 TAAGGACTCACAAAAACTTAAGG + Intergenic
976556392 4:86455423-86455445 TAAGGACTCACATAAATTTAAGG + Intronic
976562591 4:86519493-86519515 TAAGGACTCACATAAACTTAAGG - Intronic
976869760 4:89776745-89776767 TAAGGACTCACATAAACTTAAGG + Intronic
976888047 4:90009650-90009672 TAAGGACCCACATAAACTTAAGG + Intergenic
976907674 4:90260628-90260650 TAAGCATTCACATAAACTCAAGG - Intronic
976962915 4:91001627-91001649 TAGGGACTCAAATAAATTTAAGG - Intronic
977481513 4:97583645-97583667 TACAAACTCACATAAACTTAAGG + Intronic
977489424 4:97693305-97693327 TAAGGACTCACATAAACTTAAGG + Intronic
977510699 4:97958510-97958532 TAAGAACTCATATAAACTTAAGG + Intronic
977552289 4:98454983-98455005 TAAGGACTCAAATAAACTTAAGG - Intergenic
977615262 4:99081293-99081315 TAAGGAATCACAGAGACCGAGGG - Intronic
977635716 4:99295577-99295599 TAAGGACTCACATAAACTTAAGG + Intergenic
977762954 4:100761149-100761171 TAATGACTCCCATAAACTTAGGG + Intronic
977813689 4:101388563-101388585 TAAGGACTTACATAAATGTAAGG - Intergenic
977826252 4:101535267-101535289 TAAGGATTCACATATATTTAAGG + Intronic
977828932 4:101566754-101566776 TAAGGACTCACATAAACTTAAGG + Intronic
977905886 4:102477528-102477550 TAAGGACTAACATAAGCTTAAGG + Intergenic
978316748 4:107446516-107446538 TAAGGATTCACTCAAACTTAAGG - Intergenic
978762025 4:112363325-112363347 TAAGGACTCACATAAACTTAAGG + Intronic
978916318 4:114129636-114129658 TAAGAACTTGCATAAACTTAGGG + Intergenic
978925113 4:114233436-114233458 TAAAGACTCACATAAACTTAAGG + Intergenic
979020516 4:115490994-115491016 CAAGAACTCACATAAACTTAAGG + Intergenic
979029989 4:115631703-115631725 TAAGGACTCACATAAACATAAGG - Intergenic
979185216 4:117781333-117781355 GAAGAACTTAAATAAACTGAAGG - Intergenic
979195237 4:117913407-117913429 AAAGGATTCATATAAACTCAAGG - Intergenic
979357177 4:119717982-119718004 TAAGGACTCACATAAACTTAAGG + Intergenic
979461735 4:120991512-120991534 TAGGGACTCACAGAAACTTAAGG - Intergenic
979498934 4:121417008-121417030 TGAGGAGTCACATGAACTTAAGG - Intergenic
979712491 4:123796503-123796525 TAAGGACTCACATAAACTTAAGG - Intergenic
979984660 4:127298630-127298652 AAGAGACTCACATAAACTTAAGG + Intergenic
979995602 4:127427092-127427114 TAAGGACTCATATAACTTAAAGG + Intergenic
980087599 4:128407760-128407782 TAAAGACTCACATAAACTTAAGG - Intergenic
980189095 4:129500559-129500581 TAATGACTCAGCTACACTGAGGG - Intergenic
980238051 4:130133807-130133829 TAAGGACTTGCACAAACTTAAGG + Intergenic
980519128 4:133908334-133908356 TAAGGACTCCAGTAAACTTAAGG - Intergenic
980536390 4:134128943-134128965 TAAGGACTCATATAAACTTAAGG + Intergenic
980761215 4:137236914-137236936 TAAGGACTCACATAAACTTAAGG - Intergenic
981177508 4:141699697-141699719 TAAGGACTCAAATAAACTTAAGG - Intronic
981367111 4:143916243-143916265 TAAGGACTCACATAAACTTAAGG + Intergenic
981376905 4:144026478-144026500 TAAGGACTCACATAAACTTAAGG + Intergenic
981387408 4:144147828-144147850 TAAGGACTCACATAAACTTAAGG + Intergenic
981972197 4:150677494-150677516 TAAGGAATAAAATAAACTTATGG - Intronic
981985394 4:150848386-150848408 TAAGGAGATACATAAACTTAAGG - Intronic
982050066 4:151491761-151491783 ATAGAACTCACATAAACTTAAGG + Intronic
982119414 4:152127213-152127235 TAAGGACTCTCACAAACTTAAGG - Intergenic
982299335 4:153863281-153863303 TGAGGACTCACATAAACTTAAGG - Intergenic
982451237 4:155554374-155554396 TAAGGACTCACATAAACCTAAGG + Intergenic
982451246 4:155554469-155554491 TAAGGACTCACATAAACCTAAGG + Intergenic
982451255 4:155554564-155554586 TAAGGACTCACATAAACCTAAGG + Intergenic
982491951 4:156040497-156040519 GAAGGAGTCACAGAAACTTAAGG + Intergenic
982829942 4:160046440-160046462 TAAGGACTCTCATAAACTTAAGG + Intergenic
982960211 4:161826763-161826785 TAAGGACTCACATTAACTTAAGG - Intronic
982991988 4:162287977-162287999 TAAGGACTCACGTAAACTTAAGG + Intergenic
983036034 4:162866929-162866951 TAAGGACTCACATAAACTTAAGG + Intergenic
983072572 4:163286631-163286653 TAAGGACTCACATAAGCTTAAGG - Intergenic
983277642 4:165637522-165637544 TGAGGACTCATATAAACTTAAGG + Intergenic
983329274 4:166303603-166303625 TAAGGACTCACATAAACCTAAGG + Intergenic
983477335 4:168229989-168230011 TAAGGACTCACATAAATTTAAGG + Intronic
983749705 4:171251198-171251220 TAAGAACACACATAAACTTAAGG - Intergenic
983754842 4:171322036-171322058 TAAGGACTCATAGAAACTTAAGG + Intergenic
983776260 4:171610564-171610586 TAAGGACTTACATAAACTTAAGG + Intergenic
983826078 4:172262495-172262517 TCAGGACTCACATAAATTTAAGG - Intronic
983845404 4:172512311-172512333 TAAAGACTCATATAAACTTAAGG - Intronic
983962885 4:173776192-173776214 TAAGGACTCACAGAAACTTAAGG - Intergenic
984066711 4:175056937-175056959 TAAGGACTCACATAAACTTTAGG + Intergenic
984094396 4:175415782-175415804 AAAGGACACACCTAGACTGAAGG + Intergenic
984474939 4:180224084-180224106 TAAGGACTCACATAAACTTAAGG - Intergenic
984611786 4:181848726-181848748 TAAGGACAAAAATAAATTGAGGG + Intergenic
985008410 4:185558094-185558116 TAAGGACTCACATAAAATAAAGG - Intergenic
985108074 4:186518651-186518673 TAAGGACTCACATAAACTTAAGG - Intronic
985355938 4:189118926-189118948 TAAGGACTCACATAAACTTAAGG + Intergenic
985394558 4:189528385-189528407 TAAGGACTCATATTAACTAAAGG - Intergenic
985586134 5:736087-736109 TAAGGACTGAAATAAACTTAAGG + Intronic
985600553 5:827499-827521 TAAGGACTGAAATAAACTTAAGG + Intronic
986259192 5:6128086-6128108 TAATGACACACGTAAACTTAAGG + Intergenic
986634225 5:9804008-9804030 TAAGGATTCACATAAACTTAAGG + Intergenic
986799793 5:11247069-11247091 TATTGACTCTCATAAACTGCAGG + Intronic
987030216 5:13970165-13970187 TAAGGACTCACATACATTTAAGG - Intergenic
987152181 5:15054400-15054422 CAAGGACACACACAAAGTGAAGG - Intergenic
987436668 5:17903759-17903781 TAAAGACTCACATAAACTTAAGG - Intergenic
987541003 5:19256030-19256052 TCCTGACTCACATAAACTGTGGG - Intergenic
988002387 5:25365006-25365028 TAAGGACTCACATAAACATAAGG + Intergenic
988278258 5:29111701-29111723 GAAGGACTCACATAAACTTAAGG - Intergenic
988421013 5:31006269-31006291 TAAGGACTCACATAAACTTAAGG - Intergenic
988640463 5:33035660-33035682 TAAGGCCTCACACAATCTGAAGG + Intergenic
988724990 5:33917792-33917814 TAAGGACTCACATAAACTTAAGG - Intergenic
988828533 5:34965244-34965266 TAAGGACACACATAGACTGAAGG - Intergenic
988876087 5:35447492-35447514 TATAGACTCACATAAACTTAAGG + Intergenic
988929560 5:36023703-36023725 TAAGGACTCACAGAAACTTAAGG - Intergenic
989027539 5:37084878-37084900 TAAGGACTCATATAAACTTAAGG + Intergenic
989355290 5:40537521-40537543 TAAGGACTCACATAAACTTAAGG - Intergenic
989525705 5:42451778-42451800 TAAGGACTCACATAAACTTAAGG - Intronic
989562585 5:42869032-42869054 TAAGGACTCATGTAAACTTAAGG - Intronic
989689415 5:44122702-44122724 TAAGGGCTCATATAAACTTAAGG - Intergenic
989694181 5:44180521-44180543 TAAGGACTCACATAAACTTAAGG - Intergenic
989727636 5:44605613-44605635 TAAAGACTCAAATAAACTTAAGG + Intergenic
989818093 5:45761233-45761255 TAATAACTCACATAAACTTAAGG - Intergenic
990891655 5:60657163-60657185 TAAGCACTCATATAAACTAAAGG - Intronic
990899545 5:60735735-60735757 TAAGGACTCACATAAACTTAAGG - Intergenic
991414930 5:66382299-66382321 TAAGGACTCACATAAACTTAAGG + Intergenic
991543355 5:67753918-67753940 TAAGGATTCACATAAACTTAAGG + Intergenic
991924073 5:71686204-71686226 TAAGGACTCACATAAACTTGAGG + Intergenic
992239676 5:74754480-74754502 TAAAGACTCAAATAAACTTAAGG + Intronic
992335850 5:75768701-75768723 TAAGGACTCATGTAAACTTAAGG - Intergenic
992339894 5:75812733-75812755 TAAGGACTCACATAAACTTAAGG - Intergenic
992520351 5:77544436-77544458 TAAGGACTCACACAAACTTAAGG + Intronic
992599671 5:78386327-78386349 TAAGTACTCACATAAACTTAAGG - Intronic
992898837 5:81272199-81272221 TAAGAACTCACATAAACTTAAGG + Intergenic
993240938 5:85384063-85384085 TAAAGGCTCACATAGACAGAAGG - Intergenic
993269271 5:85773045-85773067 TAAGGACTCACATAAATTCAAGG - Intergenic
993365819 5:87033107-87033129 TAAGCACTCACATAAACTTAAGG - Intergenic
993409229 5:87553860-87553882 TAAGTTCTCACAAAATCTGATGG - Intergenic
993606915 5:90002325-90002347 TAAGTACTCACATTAATTTAAGG + Intergenic
993646296 5:90467546-90467568 TAAAGACTCACATGAACTTAAGG - Intronic
993743472 5:91566796-91566818 TAAGGACTCACATGAACTGAAGG + Intergenic
993747243 5:91615774-91615796 TAAGTTCTCACATGATCTGATGG - Intergenic
994034199 5:95179912-95179934 TAGGAACTCACATAAACTTAAGG + Intronic
994051118 5:95363873-95363895 TAAGGACTCACATAAACTTAAGG - Intergenic
994180606 5:96760732-96760754 TAAGGACACAAAAAAATTGAAGG + Intronic
994358167 5:98818585-98818607 TAAGGACTCACATAAACTTAAGG + Intergenic
994398901 5:99254707-99254729 TAAAGACTCACATAAACTTAAGG - Intergenic
994496746 5:100522160-100522182 CAAGGACTAACATCAACTGAAGG + Intergenic
994527380 5:100923745-100923767 TAAGAACTCACATAAACTTAAGG - Intergenic
994636265 5:102347612-102347634 TGAGGACTCACATAAACTTAAGG + Intergenic
994777973 5:104059651-104059673 TAAGGACTCACATACACTTAAGG - Intergenic
994823090 5:104678656-104678678 TAAGGACTCACATAAACTTAAGG + Intergenic
995187227 5:109284354-109284376 TAAGAATTCATATAAACTCAAGG + Intergenic
995587733 5:113665813-113665835 TATGGATTCACATAAACTTAAGG + Intergenic
995694399 5:114863940-114863962 TAAGGACTCACATAAACTTAAGG - Intergenic
995699121 5:114914189-114914211 TAAGGACTCATGTACACTTAAGG + Intergenic
995722709 5:115153155-115153177 TAAGGATTCACAAAAACTTAAGG + Intronic
996110361 5:119558643-119558665 TAAGAACTCACATAAACATAAGG + Intronic
996123844 5:119703235-119703257 TAAGGACTCACATAAAGTAAAGG - Intergenic
996141132 5:119911146-119911168 TAAGGACTCACATAAACTTAAGG - Intergenic
996197990 5:120633489-120633511 CAAGGACTCACATAAACTTAAGG + Intronic
996279623 5:121712935-121712957 TGAGGACTCACATAAACTTAAGG + Intergenic
996326810 5:122284657-122284679 TAAGAACTCACATAAACTTAAGG - Intergenic
996427292 5:123328513-123328535 TAAGGACTCGCATAAATTTAAGG - Intergenic
996495114 5:124146785-124146807 TAAGGACACACATAAACTTAAGG - Intergenic
996608819 5:125355666-125355688 TAAGGACTCACATAGACTTAAGG - Intergenic
996628938 5:125604782-125604804 GAAGGAATCCCATAAAATGAAGG + Intergenic
996632028 5:125644521-125644543 TAAGGACTCACATGAACTCAAGG + Intergenic
996657287 5:125956197-125956219 TAAAGATTCACATAAACTCAAGG + Intergenic
996678530 5:126204106-126204128 TAAGGACTCACATAAACTTAAGG + Intergenic
996694728 5:126381561-126381583 TAAGGACTCACATAAACCCGAGG - Intronic
996780061 5:127175677-127175699 TAAGGACTCACATAAACTTAAGG - Intergenic
996835205 5:127784006-127784028 TAAGGACTCTCATAAACTTAAGG - Intergenic
996875182 5:128233309-128233331 AAAGGACTCACATAAACTTAAGG - Intergenic
997003886 5:129796108-129796130 TAAGGACTCACAGAAAATTAAGG - Intergenic
997556068 5:134799912-134799934 TAGGGACAGAGATAAACTGAGGG - Intronic
997798154 5:136832290-136832312 TAAGGACTCACATAAACTTAAGG - Intergenic
997901054 5:137764779-137764801 TAAGGACTCACATAAACTTGAGG + Intergenic
998741820 5:145211974-145211996 TAAGGACTCACATAAACTCAAGG + Intergenic
998746258 5:145262957-145262979 TAGGGACTCTCATAAACTTAAGG + Intergenic
998758791 5:145409490-145409512 TAAGGCCTCACATAAACTTAAGG + Intergenic
999086297 5:148893666-148893688 ACATGACTCACATAAACTTAAGG + Intergenic
999108863 5:149097757-149097779 TAAGGACTCACATAAACTTAAGG + Intergenic
999337710 5:150736883-150736905 TAAGGACTCACATAAACTTATGG + Intronic
999484497 5:151982035-151982057 TAAGGACTCACATAAAGTAAAGG - Intergenic
999490947 5:152051237-152051259 TAAAGACTCACATAAACTTAAGG - Intergenic
999599688 5:153248429-153248451 TAAGGACTCACGTAAACTTAAGG - Intergenic
999677285 5:154016896-154016918 TAAGGACTCACGTAAGCTTAAGG + Intronic
999801073 5:155037240-155037262 GAAGGACTCCCACAAACTTAAGG - Intergenic
999818823 5:155203899-155203921 TAAGGACTCACATAAAGTAAAGG + Intergenic
999839112 5:155405122-155405144 TAAGGACCCACATAAACTTATGG + Intergenic
999913171 5:156228513-156228535 TAAGGACTCAAATAAACTTGAGG - Intronic
999930604 5:156429383-156429405 TAAGGACTCACATAAATATAAGG - Intronic
1000158863 5:158580039-158580061 TAAGGACTCACATAAAGTTAAGG - Intergenic
1000237861 5:159379409-159379431 TAAAGACTCACATAAACTTAAGG + Intergenic
1000511421 5:162188373-162188395 TAGGGACTCACATAAACTTAAGG - Intergenic
1000525408 5:162351759-162351781 TAAGGACTCACATAAGCTTAAGG - Intergenic
1000584622 5:163081685-163081707 TAAGGACTCGCATAAACTTAAGG + Intergenic
1001166872 5:169376647-169376669 AAAGGAATCACATAAACTTAAGG + Intergenic
1001176970 5:169479188-169479210 TAAGGACTCACATAAACTTAAGG - Intergenic
1001290902 5:170458978-170459000 TAAGGACACAAATAAACTTAAGG + Intronic
1001693576 5:173652184-173652206 TAAGGACTCATATAAACTTAAGG - Intergenic
1001733561 5:173979675-173979697 TAAGGACTCACATAAACTTAAGG - Intronic
1002849197 6:977717-977739 TAGGGACTCACATAAACTTAAGG - Intergenic
1002893062 6:1353873-1353895 TAAGGACTCACATAAACTTAAGG + Intergenic
1003297277 6:4842639-4842661 TAAGTACTCACATAAACTTAAGG - Intronic
1003465145 6:6372366-6372388 TAAGGACTCACATAAACTTAAGG + Intergenic
1003930215 6:10917518-10917540 TAAGGACTCACATAAACTTAAGG - Intronic
1004151983 6:13129426-13129448 TAAGGACTTATGTAAACTTAAGG + Intronic
1004189974 6:13455361-13455383 TCTGGACTCACAGAAACTGTGGG + Intronic
1004600291 6:17143296-17143318 TAAGGACTCACATAAGGTAAAGG - Intergenic
1004888731 6:20076699-20076721 TAAGGACCCACATAAACTTAAGG + Intergenic
1005191444 6:23228628-23228650 TCAGCACTCACACAAACTGAAGG + Intergenic
1005244289 6:23863942-23863964 TAAGGACTCACATAAGCTTAAGG + Intergenic
1005305544 6:24510676-24510698 TAAGGACTCACAGAAACTTAAGG - Intronic
1005431275 6:25759745-25759767 TAAGGATTCACATAAACTTAAGG - Intronic
1005435355 6:25804652-25804674 TAAGGATTCATATAAACTCAAGG + Intronic
1005691339 6:28309601-28309623 TAAGGAGTCACATAAACTTAAGG - Intergenic
1006062783 6:31437593-31437615 TAAGGACTCACATAAACTGAAGG - Intergenic
1006286466 6:33098744-33098766 TAAGGACTCACAAAAACTTAAGG + Intergenic
1007212209 6:40203647-40203669 TAAGGACACACATAGGCTGAAGG - Intergenic
1007879187 6:45142834-45142856 TAAGGACTCACATAAGGTAAAGG + Intronic
1007891094 6:45292602-45292624 TAAAGACTCACACAAACTTAAGG + Intronic
1008042086 6:46813192-46813214 TAAGGACTCACATAAACTTAAGG - Intronic
1008171885 6:48217959-48217981 CAAGGACTCACATAAATTTAAGG + Intergenic
1008190480 6:48450625-48450647 TAAGAACTCACATAAACTTAAGG - Intergenic
1008528430 6:52432069-52432091 TAAGGACTCATGTAAATTTAAGG - Intronic
1008736110 6:54546002-54546024 TAAGGAATCACTTAAACTTAAGG - Intergenic
1008775221 6:55030240-55030262 TAAGGACTCCCATAAACTTAAGG - Intergenic
1008781437 6:55110494-55110516 TAAGGATTTATATAAACTTAAGG + Intronic
1008882717 6:56397086-56397108 TAATGATTCATATAAACTCAAGG + Intergenic
1008900558 6:56610218-56610240 TAAGATGTCACAGAAACTGATGG + Intronic
1009267276 6:61571188-61571210 TAATGACTCACATAAACTTATGG + Intergenic
1009332315 6:62439372-62439394 TAAGGACTCACATAAACTTAAGG - Intergenic
1009360106 6:62801061-62801083 TAAAGATTCACATAAACTTAAGG - Intergenic
1009389520 6:63129109-63129131 ATAGGACTCACATAAACTTAAGG - Intergenic
1009453373 6:63827047-63827069 TAAGAACTCACATAAAGTAAAGG + Intronic
1009644491 6:66380056-66380078 TAAGGACTCACATAAACTTAAGG + Intergenic
1009644571 6:66381544-66381566 CAAGGACTTACATAAACTTGAGG - Intergenic
1009779638 6:68253809-68253831 TAAGGACTTCCATAAACATAAGG - Intergenic
1009800063 6:68525999-68526021 TAAGGACTCACATAAACTTAAGG - Intergenic
1009852666 6:69217122-69217144 TCAGGACTCAAAGAAACTGAAGG - Intronic
1009867100 6:69411010-69411032 TAAGGACTCACATAAACTTAAGG + Intergenic
1010015335 6:71099430-71099452 TAAGGACTCACATAAATTTAAGG - Intergenic
1010017215 6:71119332-71119354 TAAGGACTCACATAAACGTAAGG - Intergenic
1010045496 6:71438162-71438184 TAAGGACTCACATAAACTTAAGG + Intergenic
1010054962 6:71554766-71554788 TACGAGCTCACATAAACTTAAGG - Intergenic
1010181697 6:73094271-73094293 TAAGGAGTCTCACAAACTTAAGG - Intronic
1010458991 6:76092031-76092053 TAAGGACTCACACAAACTTAAGG - Intergenic
1010518274 6:76801401-76801423 TAAGGACTCACATAAACTTAAGG - Intergenic
1010633494 6:78229210-78229232 TAAGGACTCACATAAACTTAAGG - Intergenic
1010707576 6:79133298-79133320 TAAGGATTCACGTAAACTTAAGG - Intergenic
1010801691 6:80184314-80184336 TAAGGACTCACATAAACTTAAGG - Intronic
1010817303 6:80373878-80373900 TAAGGATTCACATAAACTTAAGG - Intergenic
1010862864 6:80935631-80935653 TAAGGACTCACATAAACTTAAGG - Intergenic
1010953442 6:82063660-82063682 TAGGAACTCACATACACTGTTGG + Intergenic
1011005443 6:82639382-82639404 TAAGGACTCATATAAACTTCAGG + Intergenic
1011014071 6:82735798-82735820 CAAAGACTAACATAAACAGAGGG + Intergenic
1011093311 6:83631707-83631729 TAAAGACTCACACAAACTTAAGG - Intronic
1011156448 6:84339016-84339038 TAACGACTCACATAAACTTAAGG - Intergenic
1011210340 6:84949262-84949284 TAAGGACTCACATGAACTTAAGG - Intergenic
1011319784 6:86078678-86078700 TAAGGACTCATAAAAACTTCAGG - Intergenic
1011373275 6:86663597-86663619 TAAGGACACACATAAACTTAAGG - Intergenic
1011394814 6:86895125-86895147 TAAGGACTCACAGAAACTTAAGG + Intergenic
1011564502 6:88660427-88660449 TAAGGACTCAAATAAACTCCAGG + Intronic
1011589148 6:88954253-88954275 TAAGGACTCACATAAACTTAAGG + Intronic
1011620184 6:89235298-89235320 TAAGGACTCACATAAACTTAAGG - Intergenic
1011965630 6:93154411-93154433 TAAGGACTCACAAAAACTAAAGG - Intergenic
1012203212 6:96432153-96432175 TAAGAACTCACATAAACTTAAGG - Intergenic
1012204572 6:96444501-96444523 TAAGGACTCACATAATCTTAAGG + Intergenic
1012208173 6:96487606-96487628 TAAGGACTCACATAAACTTAAGG - Intergenic
1012299046 6:97561879-97561901 TAAGGACTCAAATAAACTTAAGG - Intergenic
1012717343 6:102692741-102692763 TAAGGACTCACATAAACCTAAGG - Intergenic
1012870040 6:104661487-104661509 TAAGGACACACATAAATTTAAGG + Intergenic
1012965838 6:105671686-105671708 TAACGACTCACATAAACTTAAGG + Intergenic
1013410360 6:109878115-109878137 TAAGGAATCAGAGAGACTGATGG - Intergenic
1013686253 6:112587457-112587479 TAAGGACTCACATAAACTTAAGG - Intergenic
1013946248 6:115726442-115726464 TAAGGACTCACATAAACTTAAGG - Intergenic
1013985349 6:116185738-116185760 TAAGGACTCACACAAACTAAAGG - Intronic
1014235180 6:118946285-118946307 TAAAGACTCACATAAACTTAAGG + Intergenic
1014251579 6:119120778-119120800 TATGGACTAAAATAAAGTGATGG + Intronic
1014278414 6:119414617-119414639 TAAAGACTTACATAAACTTAAGG - Intergenic
1014532224 6:122572007-122572029 AAAGGACTCACATAAACTCATGG + Intronic
1014566749 6:122958215-122958237 TAAGAACTCACATAAGGTAAAGG + Intergenic
1014581570 6:123143860-123143882 TATTGACTCACATAAACTTAAGG + Intergenic
1014658439 6:124135393-124135415 TAAGGACTCACATAAACTTAAGG + Intronic
1014740161 6:125140166-125140188 TGAGTTCTCACATAATCTGATGG + Intronic
1014749754 6:125242663-125242685 AAAGGAATCACATCAACTTAAGG - Intronic
1014792585 6:125691499-125691521 TAAGGACTCACATAAACTTAAGG - Intergenic
1014878215 6:126687388-126687410 TAAGGACTCACATCAACTTAAGG + Intergenic
1015117582 6:129666448-129666470 TAAGAACCCACAGAAACAGAGGG - Intronic
1015222350 6:130818546-130818568 TAAGGACTCACATAAAGGGGTGG + Intergenic
1016018110 6:139206765-139206787 TAAGACCTCACATAGACTTAAGG + Intergenic
1016176079 6:141078982-141079004 TAAGGACTCACATAAATTTTAGG + Intergenic
1016289767 6:142516475-142516497 TAAGGACTCACTTAAGGTAAAGG - Intergenic
1016351557 6:143174572-143174594 CAAAGACTCACATAAACTTAAGG - Intronic
1016425398 6:143931177-143931199 TAAAGACTCACATAGACTTAAGG - Intronic
1016484853 6:144526553-144526575 TAAAAACTCACATAAACTTAAGG - Intronic
1016735374 6:147472629-147472651 TAAGAAATCACATAAACTTAAGG - Intergenic
1016909935 6:149188656-149188678 TAAGGACTCACATAAACTTAAGG - Intergenic
1017214746 6:151897554-151897576 TAAGGACTCACATAAACTTAAGG - Intronic
1017556116 6:155571155-155571177 CAAGGACTCACATAAACTTAAGG - Intergenic
1018009599 6:159657567-159657589 TAAGGACTCACATAAAGTAAAGG + Intergenic
1018168563 6:161125215-161125237 TAAAGACTCACATAAACTTAAGG - Intergenic
1018816465 6:167336261-167336283 AAAGGACTCTCATACACTGTTGG - Intronic
1018866306 6:167749035-167749057 CAAGTAATCAAATAAACTGAGGG - Intergenic
1019108901 6:169693602-169693624 TAAGAACTCACATAAACTTAAGG + Intronic
1019122903 6:169818761-169818783 TAAGCACTCACATAAACTTAAGG - Intergenic
1020332177 7:7030618-7030640 CAAGGACTCACATAAACTTAAGG - Intergenic
1020373944 7:7463928-7463950 TAAGGACTCACTTAAACTTAAGG + Intronic
1020608759 7:10369026-10369048 TAAGGACTCACATAAGATAAAGG + Intergenic
1020635099 7:10686827-10686849 TAAGGACTCATATAAACTTAAGG + Intergenic
1020815903 7:12905772-12905794 TCAGAACTCTCATACACTGACGG + Intergenic
1020866679 7:13573032-13573054 TAAGAAGTCACATAAACTTAAGG - Intergenic
1022295546 7:29048334-29048356 TAAGGACTCACATAAAGTAAAGG + Intronic
1022564964 7:31390206-31390228 TAAAGATTCACATAAACTTAAGG - Intergenic
1022690020 7:32640532-32640554 TAAGGTCTGTCACAAACTGAAGG + Intergenic
1022707039 7:32811457-32811479 TAAGAACTGACAAAAACTAAAGG - Intergenic
1022791586 7:33694512-33694534 AAAGGACTCACATAAACAGGTGG + Intergenic
1022915829 7:34951170-34951192 TAAGAACTGACAAAAACTAAAGG + Intronic
1023144564 7:37137036-37137058 TAAGGACTCACATAAATTTCAGG + Intronic
1023524510 7:41085287-41085309 TAAGTTTTTACATAAACTGATGG - Intergenic
1023657446 7:42439092-42439114 TAAAGACCCACATTAACTTAAGG - Intergenic
1023692642 7:42807356-42807378 TAAGGACTCACATAAACTTAAGG + Intergenic
1023701466 7:42895379-42895401 TAAGGACTCACATAAAGTAAAGG + Intergenic
1023720455 7:43088232-43088254 TAAGTACTCACTTAAAGGGAGGG - Intergenic
1023748766 7:43349723-43349745 TAAGGACTCACATAAAGTAAAGG - Intronic
1024174937 7:46829472-46829494 TAAGGACTCACACAAACTTAAGG + Intergenic
1024194183 7:47042742-47042764 TAAGAACTCACAGAAACTCTTGG + Intergenic
1024304677 7:47918103-47918125 TAAGGACTCGCACAGACTTAAGG + Intronic
1024327816 7:48125385-48125407 TAAGAACTGACATAAACTTAAGG - Intergenic
1024367112 7:48533868-48533890 TAAGGATACACATAAGCTTAAGG - Intronic
1024419457 7:49146080-49146102 TAAAGACTCACATAAATTTAAGG + Intergenic
1024455947 7:49606845-49606867 TAAGGACTCACATAATCTCAAGG + Intergenic
1024497252 7:50062864-50062886 TAAGGAATCAGAGAGACTGATGG + Intronic
1024498118 7:50070601-50070623 TAAGGAATCAGAGAGACTGATGG + Intronic
1024545703 7:50515699-50515721 TAAGGACTCACATAAACTTAAGG + Intronic
1024665425 7:51542243-51542265 TAAGGACTTACATAAACTGAAGG - Intergenic
1024840217 7:53576771-53576793 GAAGGACTCACACAAACTTAAGG + Intergenic
1024847619 7:53666464-53666486 TAAAGACTCACATAAACTTAAGG - Intergenic
1024863241 7:53871238-53871260 TAAGGATTCATATAGACTCAAGG + Intergenic
1024876028 7:54024721-54024743 TAAGGACTCACATAAAATTAAGG - Intergenic
1024917020 7:54513418-54513440 TAAGGACACACATAAACTTAAGG - Intergenic
1024946963 7:54818335-54818357 TAAGAACTCACATAAACTTAAGG - Intergenic
1025637017 7:63330742-63330764 TAAGGACAAACACAAAATGACGG - Intergenic
1025645678 7:63417360-63417382 TAAGGACAAACACAAAATGACGG + Intergenic
1025716194 7:63958502-63958524 TAAGGACAAACACAAAATGATGG + Intergenic
1025794600 7:64727524-64727546 TAAGGACTCACATAAACTTAAGG - Intergenic
1025807367 7:64847726-64847748 TAAGGATTCACATAAACTTAAGG - Intergenic
1025820803 7:64961263-64961285 TAAGGACTCACATAAACTTAAGG + Intergenic
1027328836 7:77069875-77069897 TAAGGACTCACATAAACTTAAGG - Intergenic
1027562999 7:79755985-79756007 TAACGACTCACATAAACTTAAGG - Intergenic
1027733057 7:81900673-81900695 TAAGGACTCACATAAGGTGAAGG - Intergenic
1027948314 7:84779886-84779908 TAAGGACTCACGTAAATGTAAGG + Intergenic
1027963679 7:84979206-84979228 TAAGGACTTGCACAAACTTAAGG - Intergenic
1028197373 7:87922526-87922548 TAAAGACTCACATAAACTTAAGG + Intergenic
1028197988 7:87929021-87929043 TAGGGACTCACATAAACTTAAGG + Intergenic
1028250750 7:88537657-88537679 TAAGGACTCACATAAACTTAAGG - Intergenic
1028261864 7:88676042-88676064 TAAGGACTCACATAAACTTAAGG + Intergenic
1028347885 7:89806102-89806124 TAAGGACTCATATAAACTTAAGG - Intergenic
1028402105 7:90434763-90434785 TGAGGACTCACATAAACTTAAGG + Intronic
1028502073 7:91529775-91529797 TAAGGACTCATATAAATTTAAGG + Intergenic
1028529453 7:91822810-91822832 TAAGGACTTCCATAAACCTAAGG - Intronic
1028783073 7:94759198-94759220 TGAGGAATCACATAAACTTAAGG + Intergenic
1028819323 7:95188355-95188377 TAAGGATTCACATAAACTTAAGG - Intronic
1028822730 7:95231025-95231047 TAAGGACTCACATAAACTTAAGG + Intronic
1028936675 7:96472611-96472633 AAAGAACTCACATAAACTTAAGG - Intergenic
1029328731 7:99833190-99833212 TAAGGAATCAGAGAGACTGATGG + Intronic
1029786932 7:102801506-102801528 TAAGGACTCACATAAACTTAAGG + Intronic
1029885350 7:103864016-103864038 TGAGAACTCAGACAAACTGAAGG + Intronic
1030141600 7:106309991-106310013 TGAGGGCTCACAAGAACTGATGG - Intergenic
1030390253 7:108919211-108919233 TAAGGACTCACACAAACTTAAGG - Intergenic
1030456062 7:109775075-109775097 TAAGGACTCACATAAACTTAAGG + Intergenic
1030533638 7:110739332-110739354 CAAGGATTCACATAAACTTAAGG + Intronic
1030780291 7:113592738-113592760 TAATAATCCACATAAACTGATGG + Intergenic
1030972512 7:116077543-116077565 TAAGAACTCATATAAACTTAAGG + Intronic
1031090243 7:117346118-117346140 CAAGGACTCACATAAACTTAAGG - Intergenic
1031139068 7:117921148-117921170 TAAAGACTCACATAAACTTAAGG + Intergenic
1031169265 7:118271839-118271861 TAAGGACTCACATAAACTTCAGG - Intergenic
1031611764 7:123836452-123836474 TAAGGACTCATATAAACTTAAGG - Intronic
1031675974 7:124612376-124612398 AAAGGACTCACATAAAATTAAGG + Intergenic
1031676993 7:124622792-124622814 TAAGGTCACACAAAGACTGAAGG + Intergenic
1031796727 7:126184611-126184633 TAAGGACTCATGTAAACTGAAGG - Intergenic
1032288897 7:130568331-130568353 TAAGGACTCACATAAACTTAAGG + Intronic
1032448721 7:132008036-132008058 TAAAGACTCACATAAATTTAAGG - Intergenic
1032538994 7:132687880-132687902 CAAGAACTGGCATAAACTGAGGG + Intronic
1032605085 7:133341905-133341927 TAAGAACTCACATAAATCTAAGG - Intronic
1032922434 7:136565181-136565203 TAAGTAGTCACATAAACTTAAGG - Intergenic
1033027018 7:137784240-137784262 TAAGGACTCAGATAAATTTAAGG + Intronic
1033400925 7:141024357-141024379 TAAGGACTCACATAAACTTAAGG - Intergenic
1033475706 7:141690230-141690252 TTAGGAGTCAGAGAAACTGAAGG - Intronic
1033623087 7:143079842-143079864 TAAGGTCTCACATAAACTTAAGG + Intergenic
1034019751 7:147628743-147628765 TAAGGACTCACATAAACTTAAGG + Intronic
1034058665 7:148065660-148065682 TAAGGACTCACATAAATGTAAGG - Intronic
1034116764 7:148590541-148590563 TAGGTACTCAAATAAACAGAAGG - Intergenic
1034247634 7:149660517-149660539 TAAGGATTCACATAAGCTTAAGG - Intergenic
1034682995 7:152945184-152945206 TAAGGACTCATATAAACTTAAGG - Intergenic
1034705307 7:153137718-153137740 TAAGGACTCACATAAACTTAAGG - Intergenic
1035151415 7:156876088-156876110 TAAGGACTCACATAAACTTAAGG + Intronic
1036108602 8:5873364-5873386 TAAGGACTCACATAAACTCAAGG - Intergenic
1036394177 8:8352836-8352858 TAAGGGCATACATAAGCTGAAGG + Intronic
1037320636 8:17639134-17639156 ATAGGACTAACATAAACTTATGG - Intronic
1037865602 8:22440575-22440597 GAATGACCCACAAAAACTGAAGG + Intergenic
1039030293 8:33301454-33301476 ATAGGACTCACATAAACTTAAGG + Intergenic
1039112366 8:34054145-34054167 TAAGCACTCACATAAACTTAGGG + Intergenic
1039312992 8:36339754-36339776 TAAAGACACACATAAGTTGAAGG + Intergenic
1039642548 8:39239694-39239716 TAAGGATTCACATAAACTTAAGG + Intronic
1039763683 8:40606045-40606067 TAAGGACTCACATAAACTGAAGG - Intronic
1039810312 8:41042181-41042203 TAAGGACTCACATAAACTTAAGG - Intergenic
1040442636 8:47460534-47460556 TAAGGACTCAGATAAACTTAAGG - Intronic
1040511219 8:48097337-48097359 TAAAGACACACATAGACTGAAGG - Intergenic
1040529166 8:48251995-48252017 TAAGGACTCATGTAAACTTAAGG - Intergenic
1040670907 8:49689562-49689584 TAAGGACTCACATAAACTTAAGG - Intergenic
1040692745 8:49959351-49959373 TTTGGAATCCCATAAACTGAGGG - Intronic
1040820338 8:51548946-51548968 TAAGGACTCACATAAACTTAAGG + Intronic
1040867812 8:52068443-52068465 TAAGGACTTACATAAACTTAAGG - Intergenic
1040989367 8:53333295-53333317 TAAGGACTCACATAAACTTAAGG - Intergenic
1041150511 8:54927694-54927716 TAAGGAGTCACATAAACTTAAGG + Intergenic
1041152889 8:54954849-54954871 TGAGTACTCACCTAAAATGATGG - Intergenic
1041897329 8:62940027-62940049 TAAGGACTCACATAAACTTAAGG + Intronic
1042069994 8:64921866-64921888 TAAAGACACACACAGACTGATGG - Intergenic
1042084384 8:65091672-65091694 TAAGGAATCACATAAACTTAAGG + Intergenic
1042160776 8:65892211-65892233 ATAGGACTCACATAAACTTAAGG + Intergenic
1042431588 8:68712458-68712480 TAAGGACTCATATAAACTTAAGG + Intronic
1042728836 8:71908712-71908734 TATGGATTCACGTAAACTTAAGG - Intronic
1042768243 8:72350870-72350892 TAAGGACTCACATAAACTTAAGG - Intergenic
1042897035 8:73681744-73681766 TAAGGACTCACATAAACTGAAGG + Intronic
1042995714 8:74695578-74695600 TAAGGACTTACATAAATTTAAGG + Intronic
1043040974 8:75261454-75261476 TAAGGACTCACACAAACTTAAGG + Intergenic
1043048861 8:75360277-75360299 TAAGGACTCTCACCAACTTAAGG + Intergenic
1043186882 8:77163573-77163595 AGAGGAATCACATAGACTGAAGG + Intergenic
1043537601 8:81223705-81223727 TAAGGGCTCACATAAACTTAAGG - Intergenic
1043545307 8:81308407-81308429 TAAGGACTCACATAAAGTAAAGG + Intergenic
1043616566 8:82132233-82132255 TAAGGACTTACATAAACTTAAGG + Intergenic
1043679098 8:82998911-82998933 GAAGAACTCACATAAAGTTAAGG + Intergenic
1043876178 8:85489404-85489426 TAAGGAGTCACATAAACTTAAGG - Intergenic
1043985650 8:86692599-86692621 AAAGGACTCACATAAACTTAAGG - Intronic
1043988035 8:86716987-86717009 TAATGACTCACATAAACTTAAGG + Intronic
1044292079 8:90484109-90484131 TAAGGACTCACATAAACTTAAGG + Intergenic
1044398142 8:91738196-91738218 TAATGTCTCATTTAAACTGAAGG - Intergenic
1044657146 8:94560743-94560765 TAAGGAATCACATAAACTTAAGG - Intergenic
1044907437 8:97019494-97019516 TAAGTGCTCACATAAACTTAAGG + Intronic
1044927353 8:97220950-97220972 TAAGGAGTCACATGAGATGAAGG - Intergenic
1045122111 8:99049033-99049055 TAAGGACTCACATAAACTTAAGG - Intronic
1045634661 8:104170530-104170552 TAAGCACTCTCATAAACTTAAGG - Intronic
1045814097 8:106259672-106259694 TAAGGACTCACGTAAACTTAAGG - Intergenic
1045945570 8:107791332-107791354 TAAAGACACACAGAGACTGAAGG + Intergenic
1046033712 8:108815612-108815634 TAATGACTCACATAAACTTAAGG - Intergenic
1046075564 8:109307741-109307763 TCACGATTCACATAAACTTAAGG + Intronic
1046284546 8:112077787-112077809 TAAGGATTCATATAAACTCAAGG - Intergenic
1046369386 8:113281530-113281552 TAAGGACTCACATAAACTAAAGG - Intronic
1046448833 8:114360313-114360335 TAAGGACCCACATAAACTTAAGG + Intergenic
1046483142 8:114850170-114850192 TAGGGACTGAAATAAGCTGATGG + Intergenic
1047029732 8:120863185-120863207 TAAGTTCTCACAAAATCTGATGG - Intergenic
1047032565 8:120898228-120898250 TAAGGACTCACATAAAGTAAAGG + Intergenic
1047227130 8:122966022-122966044 TAAGGATTCACATAAACTTAAGG - Intronic
1047592202 8:126338472-126338494 TAAGGACTCACATAAACTTAAGG + Intergenic
1047607096 8:126486140-126486162 TGAAGACTCACATAAACTTAAGG - Intergenic
1047798160 8:128279250-128279272 TAGGGACTCACATAAACTTAAGG + Intergenic
1047842592 8:128769198-128769220 TAAAGATTCACATAAACTTAAGG + Intergenic
1047890254 8:129301091-129301113 TGAGGATTCACATAAACTTAAGG - Intergenic
1047901624 8:129429192-129429214 TAAGGACTCACATAAACTTAAGG - Intergenic
1047937172 8:129793896-129793918 TAAGGACTCACGTAAACTTAAGG - Intergenic
1047937229 8:129794622-129794644 TAAGGACTCACATAAACTCAAGG - Intergenic
1048078555 8:131100034-131100056 TAATGACACACATGAACTCAGGG + Intergenic
1048120243 8:131572494-131572516 TAAGGACTCATGTAAACTTAAGG - Intergenic
1048281578 8:133109520-133109542 TCAGGAGTCACAGAAATTGAAGG + Intronic
1048371491 8:133781955-133781977 TAAGAACTCACATAAACTTAAGG - Intergenic
1048405624 8:134117353-134117375 CAAAGACTCACATAAAATCATGG + Intergenic
1048530849 8:135248989-135249011 AAAGGATTCACATAAACTTAAGG - Intergenic
1049120679 8:140734218-140734240 TAAAAACTCACATAAAATGGAGG + Intronic
1049123976 8:140769139-140769161 TAAAGACTCACAGAAACTAACGG - Intronic
1049869532 8:144963574-144963596 TAAGGACTCACATAAACTTAAGG - Intergenic
1049897901 9:127551-127573 TAAGGACTCACATAAACTTAAGG - Intronic
1050776313 9:9266001-9266023 TAAGGACATACATAAGGTGAAGG + Intronic
1050903722 9:10977100-10977122 CAAGGACTCACATAAACTTAAGG + Intergenic
1050936086 9:11397213-11397235 TAAGAACTCACATAAACTTAAGG + Intergenic
1050987943 9:12106432-12106454 TAAGGAATCACATAAACTTAAGG + Intergenic
1051601162 9:18876113-18876135 TAAGGACTCACATAAACTTAAGG - Intronic
1051733389 9:20171484-20171506 TAAGGACTCACATAAACTTAAGG + Intergenic
1051816754 9:21117630-21117652 TAAGGACTCACATAAACTTCAGG - Intergenic
1051840180 9:21387613-21387635 TAAAGACACATATAGACTGAAGG - Intergenic
1051885509 9:21888690-21888712 CAGGGACTGACATAAACTTAAGG - Intronic
1052006472 9:23355818-23355840 TAAGGACTCACATAAACTTAAGG - Intergenic
1052218509 9:25994464-25994486 TAAGGACTCACATAAACTTAAGG + Intergenic
1052250421 9:26391024-26391046 TAAGTTCTCACATGATCTGATGG + Intergenic
1052307427 9:27026104-27026126 TAAGGTCTCACATAAACTTAAGG + Intronic
1052525307 9:29610229-29610251 TAAGGACACACATAGACTTCAGG + Intergenic
1052550073 9:29937078-29937100 TAAGGACTCACATAAACTTAAGG - Intergenic
1053107068 9:35418956-35418978 TAAGGATTTATATAAACTCAAGG + Intergenic
1053126750 9:35587283-35587305 ACAGGATTCACATAAACTTAAGG + Intergenic
1053220025 9:36304819-36304841 TAAGGAATCAGAAAGACTGAGGG - Intergenic
1053231499 9:36414115-36414137 TAAGGACTCACATAAACATAAGG - Intronic
1053648729 9:40141559-40141581 TAAGGAATCAGAGAGACTGATGG - Intergenic
1053740981 9:41137844-41137866 TAAGGACTCACATAAACTTAAGG - Intronic
1053753350 9:41278165-41278187 TAACGACCTACATAAACTTAAGG - Intergenic
1053757015 9:41322283-41322305 TAAGGAATCAGAGAGACTGATGG + Intergenic
1054258878 9:62842531-62842553 TAACGACCTACATAAACTTAAGG - Intergenic
1054329709 9:63739500-63739522 TAAGGAATCAGAGAGACTGATGG - Intergenic
1054332905 9:63777512-63777534 TAACGACCTACATAAACTTAAGG + Intergenic
1054443969 9:65293987-65294009 TAAGGACTCACATAAACTTAAGG - Intergenic
1054486304 9:65727519-65727541 TAAGGACTCACATAAACTTAAGG + Intronic
1054535852 9:66234611-66234633 TAAGGAATCAGAGAGACTGATGG + Intergenic
1054687368 9:68293453-68293475 TAAGGACTCACATAAACTTAAGG + Intronic
1054844622 9:69780767-69780789 TAAGGACTCACATAAACTTAAGG - Intergenic
1054938996 9:70719646-70719668 TAAGGACTCACATAAACTTAAGG + Intronic
1054940687 9:70737639-70737661 TAAGGACTCACATAAACTTAAGG + Intronic
1055125138 9:72710715-72710737 TAAGGACTCACATAAAGTTGAGG - Intronic
1055138102 9:72846189-72846211 ACAGGACTCACATAAACTTAAGG + Intergenic
1055156502 9:73068826-73068848 AAAGGGCTCACATAAACTTAAGG + Intronic
1055181954 9:73399648-73399670 TAAGGACTCATGTAAACTTAGGG - Intergenic
1055244757 9:74226285-74226307 TAAGGATTCACATAAACTTAAGG + Intergenic
1055846725 9:80573887-80573909 TAAGGACTCACATAAACTTAAGG + Intergenic
1056025809 9:82494199-82494221 TAAGGACTCACATAAACTTAGGG - Intergenic
1056026872 9:82506893-82506915 TCAGGATTCACATAAACTTAAGG + Intergenic
1056309630 9:85326295-85326317 TAAGAACTCACATAAACTTAAGG + Intergenic
1056312729 9:85357701-85357723 CAAGGACTCACATAAACTTAAGG - Intergenic
1056396892 9:86189469-86189491 TAAGGACTCACATAAACTTAAGG + Intergenic
1056696393 9:88858145-88858167 TAAGGACTCACATAAACTTAAGG + Intergenic
1056948263 9:91019591-91019613 TAAGGACTCACATAAACTTAAGG + Intergenic
1057340333 9:94195461-94195483 TAAGGATTCATATAAACTCAAGG - Intergenic
1057475905 9:95401274-95401296 GAAGGATTCACATAAACTTAAGG + Intergenic
1057643077 9:96846461-96846483 GAAGGATTCATATAAACTCAAGG + Intronic
1058233764 9:102463314-102463336 TAAAGACTCACATAAACTTAAGG + Intergenic
1058693575 9:107539819-107539841 GAAGGACTGAATTAAACTGAAGG - Intergenic
1058770865 9:108230137-108230159 TAAGGACACACGTAAAGTAAAGG + Intergenic
1058784371 9:108372613-108372635 TAACTACTCACATAAACTTAAGG - Intergenic
1058925453 9:109658748-109658770 TAAAGTCTCACACGAACTGATGG - Intronic
1059022084 9:110587414-110587436 TAAGGACTCACATAAACTTAAGG - Intergenic
1059032878 9:110719356-110719378 TAAGGACTAACATAAACTTAAGG + Intronic
1060311007 9:122462289-122462311 TAAGGACTCACATACACTTAAGG - Intergenic
1060314264 9:122494554-122494576 TAAGGACTCACATACACTTAAGG - Intergenic
1202796493 9_KI270719v1_random:124857-124879 TAAGGAATCAGAGAGACTGATGG - Intergenic
1202799901 9_KI270719v1_random:165823-165845 TAATGACCTACATAAACTTAAGG + Intergenic
1186308616 X:8292079-8292101 TAAGAACTCATATAAACTTAAGG + Intergenic
1187109091 X:16277472-16277494 TAAGGACTCACATAAACTTAGGG - Intergenic
1187187078 X:16997323-16997345 TAAGAACTAACATTTACTGAGGG - Intronic
1187589046 X:20695422-20695444 AAAGGACTCACATAAACTTAAGG + Intergenic
1187752005 X:22477089-22477111 TAAGGATTCACATAAACTTAAGG - Intergenic
1187946685 X:24433067-24433089 TAAGGAATCAGAGAGACTGATGG + Intergenic
1188040328 X:25364466-25364488 TAAGGACTCACACAAACTTAAGG - Intergenic
1188058447 X:25569648-25569670 TAAGGACTTAAATAAACTCAAGG - Intergenic
1188380440 X:29484980-29485002 AAAGGATTAACACAAACTGAAGG + Intronic
1188389170 X:29598903-29598925 TAAGGATTCACATAATCTTAAGG - Intronic
1188719194 X:33502096-33502118 TAAGGACTCACATAAACTTAAGG + Intergenic
1188956411 X:36439468-36439490 TAAGGATTCATATAAACTTAAGG + Intergenic
1189413863 X:40796693-40796715 TAAGGACTCACATAAAGTAAAGG + Intergenic
1189567399 X:42257010-42257032 CAAGGACTCACATAAACTTAAGG + Intergenic
1189599954 X:42613659-42613681 AAAGGACTTACATAAACCTAAGG - Intergenic
1189639129 X:43048901-43048923 TAAGGATTCACATAAACTTAAGG - Intergenic
1189663060 X:43324405-43324427 TAAGGACTCACATAAACTTAAGG - Intergenic
1189945809 X:46177443-46177465 TAAGGACTCACATAAACTTAAGG - Intergenic
1190895280 X:54612289-54612311 TAAGGACTAACATAAAGTAAAGG - Intergenic
1190897131 X:54631638-54631660 TAAGGTTTCACATAAACTTAAGG - Intergenic
1191045512 X:56131753-56131775 TAAGGACACACATAAACTTAAGG + Intergenic
1191077108 X:56466945-56466967 CAAGAACTCACAGAAACTTAAGG - Intergenic
1191100467 X:56721199-56721221 TAAGGAAACAAATAAACTTAAGG + Intergenic
1191139495 X:57101558-57101580 TAAGGACTCACATAAACTTAAGG + Intergenic
1191144653 X:57153238-57153260 TAAGGACTCACATAAACTTAAGG - Intergenic
1191179779 X:57548694-57548716 TAAGGACACACATAAATTTAAGG + Intergenic
1191223098 X:58012442-58012464 TAAGGACTCACATAAACTTAAGG - Intergenic
1191741709 X:64442946-64442968 TAAGGACTCATATAGACTTAAGG + Intergenic
1191787447 X:64932230-64932252 TAAGGACTCATGTAAGCTTAAGG - Intronic
1191806858 X:65145341-65145363 TATGGACTCACACAAACTTAAGG - Intergenic
1191819951 X:65294618-65294640 TAAGGACTCACATAAAGTTAAGG + Intergenic
1191879495 X:65830652-65830674 TAAGGATTTATATAAACTTAAGG + Intergenic
1191888703 X:65918444-65918466 TGAGGACTCAAATAATCTTAAGG - Intergenic
1191906095 X:66092131-66092153 TAAGGACCCATATAAACTTATGG - Intergenic
1191917420 X:66217804-66217826 TAAGGACTCACATAAACTTAAGG + Intronic
1191945023 X:66524189-66524211 TAAGGACTCACATAAACTTAAGG - Intergenic
1191970748 X:66813528-66813550 TAAGGAATTACATAAAATTAAGG - Intergenic
1192009135 X:67249678-67249700 TAAGGGCTTGCATAAACTTAAGG + Intergenic
1192164165 X:68814837-68814859 TAAGGACTCACAAAAACTTAAGG + Intergenic
1192609843 X:72556520-72556542 TAAGGACTTACATAAACTGAAGG + Intronic
1192688459 X:73333010-73333032 TAAAGACTTACATAAACTTGAGG - Intergenic
1192691055 X:73365049-73365071 TAAAGACTCACATAAATGTAAGG - Intergenic
1192876815 X:75238248-75238270 TAAGGACTCACATAAACTTAAGG + Intergenic
1192878328 X:75255629-75255651 CAAGGACTCACATAAAATGAAGG + Intergenic
1192880904 X:75283147-75283169 TGAGGACTCACACAAACGTAAGG - Intronic
1192885432 X:75332680-75332702 TAAGGACTCATATAGACTCAAGG - Intergenic
1192895451 X:75438533-75438555 AAAGGACTGACATAAACTTAAGG - Intronic
1192900979 X:75496122-75496144 TATGGACTCACATAAACTTAAGG + Intronic
1192904765 X:75539517-75539539 TATGGCCTCACATAAACATAAGG - Intergenic
1192930875 X:75804698-75804720 AAATGACTCACATAAACTTAAGG + Intergenic
1192982171 X:76356384-76356406 TAAGGATTCGTATAAACTCAAGG + Intergenic
1192987014 X:76410564-76410586 TAAGGACTCACATAAACTTAAGG + Intergenic
1192991678 X:76465742-76465764 TAAGGACTCACAGAAACTTAAGG - Intergenic
1192993792 X:76490765-76490787 AAAGGACTCATATAAACTTAAGG - Intergenic
1193015533 X:76728939-76728961 TAAGGACTTACATAAACTTAAGG + Intergenic
1193078146 X:77377115-77377137 TAAGGAATCACATAAACTTAAGG + Intergenic
1193182569 X:78475721-78475743 TAAGGACTCACATAAACTTAAGG - Intergenic
1193203258 X:78717125-78717147 TAAGGACTCAGACAAACTTAAGG + Intergenic
1193204356 X:78730199-78730221 TAAGTTCTCACAAGAACTGATGG - Intergenic
1193208537 X:78778013-78778035 CAAGGACTCACATAAACTTAAGG - Intergenic
1193255560 X:79344458-79344480 TGAGGATTCATATAAACTTAAGG + Intergenic
1193289858 X:79760088-79760110 TAAGGACTCACATAAACTTAAGG - Intergenic
1193314868 X:80053241-80053263 TAAGGACTCACATAAACTTAAGG - Intergenic
1193366501 X:80639989-80640011 TAAGGACTTACACAAACTTAAGG + Intergenic
1193382820 X:80835898-80835920 TAAGGACTCACATAAACCTAAGG + Intergenic
1193415513 X:81218123-81218145 TAAGGACTCATATGAACTTAAGG - Intronic
1193421011 X:81281955-81281977 TAAGGAGGCACATAAAGTAAAGG + Intronic
1193437910 X:81501427-81501449 TAAGGATTCACATAAAGTGGTGG - Intergenic
1193488107 X:82112887-82112909 TAAAGACACACATAGACTAAAGG - Intergenic
1193590886 X:83387489-83387511 TAAGAACTCACAGAAACTTAAGG + Intergenic
1193618867 X:83725950-83725972 TAAGGACTCACATAAACTTAAGG + Intergenic
1193624652 X:83802896-83802918 TAAGGACACACATAGGCTCAAGG - Intergenic
1193632036 X:83901346-83901368 TTAAGACTCACACAAACTTAAGG + Intergenic
1193723414 X:85014195-85014217 TAAGGACTCACATATACTTAAGG - Intronic
1193736574 X:85164125-85164147 TAAGGACTCACATAAATTTAAGG - Intergenic
1193775767 X:85640135-85640157 TAAGGACTCACATAAACTTAAGG - Intergenic
1193785822 X:85758768-85758790 TAAGGACTCACATACACTTAAGG - Intergenic
1193791827 X:85823662-85823684 TAAAGACTCACACAAACTTAAGG + Intergenic
1193817365 X:86120294-86120316 TAAGGACTCATATAAACTTAAGG - Intergenic
1193937337 X:87638962-87638984 TAAGGACTCAAATAAACTTAAGG + Intronic
1193954461 X:87842686-87842708 TAAGGACTCATATAAACTTATGG - Intergenic
1193964154 X:87963250-87963272 GAAGGATTCACATAAACTCAAGG + Intergenic
1193965314 X:87977620-87977642 TAAGTACTCATATGAACTGAAGG + Intergenic
1194001585 X:88436263-88436285 TAAATACTCACATAAACTTAAGG + Intergenic
1194058585 X:89167603-89167625 TAAGGACTCACATAAACTTAAGG + Intergenic
1194103427 X:89736703-89736725 TAAGGACTCACAAAAACTTAAGG - Intergenic
1194144522 X:90246214-90246236 TAAGAATTCATATAAACTCAAGG + Intergenic
1194165534 X:90509927-90509949 TAAGGACTCACATAAACTTAAGG + Intergenic
1194168275 X:90549776-90549798 TGAGGACTCACATTAACTTAAGG + Intergenic
1194191808 X:90846618-90846640 TAAGAACTCACATAAATTTCAGG - Intergenic
1194224725 X:91242738-91242760 TAAGGACTCACATAAACTTAAGG - Intergenic
1194232157 X:91337567-91337589 TAAGGTCTCACATAAACTTAAGG + Intergenic
1194237391 X:91401048-91401070 TAAGGGCTCACTTAAACTTAAGG + Intergenic
1194262879 X:91718652-91718674 TAAGGACTCATATAAACTTAAGG + Intergenic
1194278400 X:91915457-91915479 TAAGGACTCACATAAACTTAAGG + Intronic
1194381295 X:93194409-93194431 TAAGGACTCATATAAACTTCAGG + Intergenic
1194470069 X:94283492-94283514 TAAGGACTGACATAAACTTAAGG - Intergenic
1194532990 X:95073851-95073873 TAAGTCCTCACATAAACTTAAGG + Intergenic
1194557072 X:95372803-95372825 GAAGGATTCATATAAACTCAAGG + Intergenic
1194596556 X:95866265-95866287 GAAGGACTCATACAAACTCAAGG + Intergenic
1194606422 X:95984665-95984687 TAAGGACTCACATAAACTTAAGG - Intergenic
1194617097 X:96118415-96118437 TAAGGACTCATATAAACCTAAGG + Intergenic
1194630464 X:96276416-96276438 CAAGGACTCACATAAACTTAAGG + Intergenic
1194868086 X:99094358-99094380 TCAGGACTCACATAAACTTAAGG - Intergenic
1194934785 X:99935994-99936016 TAAGGACTCACATAAACTTAAGG - Intergenic
1194967539 X:100305687-100305709 TAGGAACTCACATAAACTTAAGG + Intronic
1195015934 X:100780808-100780830 TAAGGACTCACATAAAGTAAAGG - Intergenic
1195076261 X:101329754-101329776 TAAGAACTCACATAAACTTAAGG + Intergenic
1195231790 X:102857606-102857628 TAAGGACTCATATAAACTTAAGG - Intergenic
1195237316 X:102913459-102913481 TAAGGACTCACATAAACTTAAGG + Intergenic
1195816972 X:108898652-108898674 TAAGGTCACACATAGACTTAAGG + Intergenic
1195818231 X:108911809-108911831 TAAGGACTCACATAAACTTACGG + Intergenic
1195838470 X:109145918-109145940 TAAGAACTCATGTAAACTTAAGG + Intergenic
1195855428 X:109326859-109326881 TAAGGACTCACATAAACTTAAGG + Intergenic
1195972560 X:110489687-110489709 TAAGAACTCATATAAACTTAAGG - Intergenic
1195984975 X:110619912-110619934 TAAGGACTCACAAAAACTTAAGG - Intergenic
1196024193 X:111022805-111022827 TAAGGATTCACATAAACTTAAGG + Intronic
1196224979 X:113156097-113156119 TAATGACTCGCACAAACTTAAGG - Intergenic
1196477875 X:116110182-116110204 TAAGGACTCACACAAACTTAAGG - Intergenic
1196484703 X:116192138-116192160 TAAAGATACACATAAACTTAAGG - Intergenic
1196519199 X:116653145-116653167 TAAGAACTCACATAAACTTAAGG - Intergenic
1196867090 X:120079938-120079960 TAAGGAATCAGAGAGACTGATGG + Intergenic
1196876009 X:120156344-120156366 TAAGGAATCAGAGAGACTGATGG - Intergenic
1196883864 X:120224299-120224321 TAAGGAATCAGAGAGACTGATGG + Intergenic
1196948021 X:120848146-120848168 TAAGGACTCACACAAACTTAAGG - Intergenic
1196949235 X:120859518-120859540 TAAGGACTCACATAAACTTAAGG + Intergenic
1196994498 X:121366803-121366825 TAAGGACTCACATAAGCTTAAGG - Intergenic
1197054458 X:122099571-122099593 TAAGGACTCACATAAACTTAAGG - Intergenic
1197055309 X:122111895-122111917 TAGGGACTCACATAAACTCAAGG - Intergenic
1197081559 X:122424612-122424634 TAAGGACTCACATAAACTTAAGG - Intergenic
1197363768 X:125538280-125538302 ATAGGACTCACATAAACTAAAGG + Intergenic
1197463599 X:126773459-126773481 TAAGAACTCACATAAACTTAAGG + Intergenic
1197471997 X:126875564-126875586 TAAGAATTTACATAAACTTAAGG - Intergenic
1197476118 X:126927796-126927818 TAAGGACTCACATTAACTTAAGG - Intergenic
1197504104 X:127280185-127280207 TAAGGACTCACATAAACTTAAGG + Intergenic
1197515353 X:127421275-127421297 TAAGGAGTCACATAAGCTTAAGG - Intergenic
1197545456 X:127818151-127818173 TAAGGACTCACATAAACTTAAGG + Intergenic
1197562340 X:128038732-128038754 TAAGGATTGAAATAAACTAAAGG - Intergenic
1197571984 X:128161366-128161388 TAAATACTCACATAAACTTAAGG - Intergenic
1197574262 X:128189841-128189863 TAAGGACTCACATAAACTTAAGG + Intergenic
1197664417 X:129208580-129208602 TAAGGACTCACATAAACTTAAGG - Intergenic
1197911184 X:131483933-131483955 TAAGGACTCACATAAACTTAAGG + Intergenic
1198483719 X:137065502-137065524 TAAGGACTCAAATTATCTGGAGG - Intergenic
1198559682 X:137836090-137836112 TAAGGACTCACATAAACTTAAGG - Intergenic
1198583085 X:138088530-138088552 TAAGGACTGACATAAACTTAAGG + Intergenic
1198616641 X:138465123-138465145 TAAGGACTCATATAAACTTAAGG + Intergenic
1198664934 X:139009923-139009945 TAAGGACCCACATAAACTTAAGG + Intronic
1198696059 X:139339549-139339571 TAAGGACTCACATAAACTTAAGG - Intergenic
1198712664 X:139522824-139522846 TAAGGACTCACATAAACTTAAGG + Intergenic
1198797084 X:140408783-140408805 TAAGGACTCACATAAACTTAAGG - Intergenic
1199065763 X:143416357-143416379 TAAGGATTCATATAAATTCAAGG - Intergenic
1199077403 X:143539896-143539918 CAAGGATTCATATAAACTCAAGG + Intergenic
1199121807 X:144063050-144063072 TAAGAACTCATATAAACTTAAGG + Intergenic
1199241941 X:145557104-145557126 TAAGGATTCCTATAAACTCAAGG + Intergenic
1199283578 X:146030889-146030911 TAAGGACTCACATAAATTTAAGG + Intergenic
1199323128 X:146464157-146464179 TAAGGATTCATATAAACTCAAGG - Intergenic
1199372789 X:147071246-147071268 AGAGGACTGACATAAAATGAAGG + Intergenic
1199587056 X:149425702-149425724 TAAGGACTCACATAAACTTAAGG + Intergenic
1200293759 X:154896563-154896585 TGTGGACTCACATAAGCTAATGG + Intronic
1200317909 X:155153697-155153719 TAAGGACTCACATCAACTTAAGG - Intergenic
1200332863 X:155315886-155315908 TAAGGACTCAGGTAAACTTAAGG + Intronic
1200511801 Y:4087736-4087758 TAGGGACTCATATAAACTTAAGG + Intergenic
1200514519 Y:4127556-4127578 TGAGGACCCACATTAACTTAAGG + Intergenic
1200538451 Y:4429052-4429074 TAAGAACTCACATAAATTTCAGG - Intergenic
1200561189 Y:4706048-4706070 TAAGGACTCACATAAACTTAAGG - Intergenic
1200595735 Y:5137537-5137559 TAAGGACTCACATAAACTTAAGG + Intronic
1200738331 Y:6825873-6825895 TAATGACTCATATAAACTTAAGG - Intergenic
1201315986 Y:12645981-12646003 TAAGGACTCACATAAACTTCAGG + Intergenic
1201408747 Y:13676095-13676117 TAATGACTCATAAAAACTTAAGG + Intergenic
1201644414 Y:16213421-16213443 TAAGGAATCAGAAAGACTGATGG + Intergenic
1201658401 Y:16371900-16371922 TAAGGAATCAGAAAGACTGATGG - Intergenic
1201746380 Y:17378755-17378777 TAAGGAATCAGAGAGACTGAGGG + Intergenic
1201930813 Y:19344530-19344552 TAAGGACTCACATATAATTGAGG - Intergenic
1202036229 Y:20639446-20639468 TAAGGACTCACATAAACTTAAGG - Intergenic