ID: 1039763684

View in Genome Browser
Species Human (GRCh38)
Location 8:40606063-40606085
Sequence AGACTAATCGAACACACATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039763684_1039763686 -1 Left 1039763684 8:40606063-40606085 CCTTATGTGTGTTCGATTAGTCT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1039763686 8:40606085-40606107 TCTTGAAGACAGTGGATACTTGG No data
1039763684_1039763687 3 Left 1039763684 8:40606063-40606085 CCTTATGTGTGTTCGATTAGTCT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1039763687 8:40606089-40606111 GAAGACAGTGGATACTTGGTTGG No data
1039763684_1039763685 -9 Left 1039763684 8:40606063-40606085 CCTTATGTGTGTTCGATTAGTCT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1039763685 8:40606077-40606099 GATTAGTCTCTTGAAGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039763684 Original CRISPR AGACTAATCGAACACACATA AGG (reversed) Intronic
908482491 1:64555824-64555846 AGAATATTTGAAAACACATATGG - Intronic
918641518 1:186846599-186846621 AGACTAATGGAATCCAAATAAGG - Intronic
923324328 1:232867654-232867676 AAAATTATTGAACACACATATGG - Intergenic
1066477209 10:35759360-35759382 AGACAAATCTGAAACACATACGG + Intergenic
1070919663 10:80176648-80176670 AGACTAAAAGAACACACACAGGG + Intronic
1073547054 10:104359172-104359194 AGAATAATGCAACACACTTAAGG - Intronic
1075323918 10:121514812-121514834 AGTCTGATCAAACACACACAGGG + Intronic
1076476191 10:130753622-130753644 AGACAAATAGAACAAACAAATGG + Intergenic
1078760080 11:14244797-14244819 AGACTAAGCGAAGTCACAGAGGG - Intronic
1081280974 11:41209008-41209030 AGAGCAAACGAACAGACATAGGG + Intronic
1084395286 11:68905231-68905253 AGACAAATCCTACCCACATATGG - Intronic
1091599665 12:1910148-1910170 AGACAAAAGGCACACACATATGG + Intronic
1096132209 12:49168586-49168608 AAACTAATCGAACCCAAAGAAGG + Intergenic
1096316552 12:50572177-50572199 AGAGAAATGGAACACACATGAGG - Intronic
1098582194 12:72113494-72113516 AGACCAATCGGAGAAACATAGGG - Intronic
1105803472 13:23933104-23933126 ACACTATTGGAACACACAGAAGG - Intergenic
1107296156 13:38910396-38910418 ACACTATTGGAACACACAGAAGG + Intergenic
1108301652 13:49083249-49083271 AGACTCCTCAAACACACAAAGGG + Intronic
1109614612 13:64814593-64814615 AGACTAATCCAACAGGCCTAAGG - Intergenic
1113447496 13:110380605-110380627 AGGCTCATCGAACACCCACAGGG + Intronic
1117624387 14:57620050-57620072 ACACCAATCAAACACACATTTGG - Intronic
1121475843 14:94201708-94201730 AGACTCACCAAACACACATAAGG - Intronic
1121481624 14:94281969-94281991 TGACTAATTGAACACAAACAAGG + Exonic
1126871982 15:52999430-52999452 AGAATAGTCGAACACATAGAAGG + Intergenic
1131353518 15:91723247-91723269 AAATTAATCGAACACAAATGAGG - Intergenic
1138847858 16:60588728-60588750 AAAATAATGGATCACACATAAGG - Intergenic
1140637933 16:76938589-76938611 AGACTGAAGGAACACACAAATGG + Intergenic
1143342320 17:6222466-6222488 AAAATAAGTGAACACACATACGG + Intergenic
1155542554 18:26883823-26883845 AGACTAATGGAACAGACAGGAGG + Intergenic
1157455605 18:47826139-47826161 AGCCTAATCTAATATACATAAGG - Exonic
1158017336 18:52799047-52799069 ACATTAATAAAACACACATAAGG - Intronic
1159232131 18:65622184-65622206 AGAGTATGCAAACACACATAGGG - Intergenic
1164542185 19:29129339-29129361 AGACGATTTGAAGACACATATGG + Intergenic
928062071 2:28124186-28124208 TGACCAATCTAACTCACATAGGG + Intronic
929603059 2:43216880-43216902 AGGGAAATTGAACACACATAGGG - Intergenic
930321281 2:49857576-49857598 TGACTAATGGACCACACACAGGG - Intergenic
930937038 2:56966169-56966191 AGACTAATCTCACAGACACAAGG - Intergenic
931002298 2:57800127-57800149 AGAGTAATTGAACACACACATGG - Intergenic
939680622 2:145127758-145127780 AGACTATTAGAACACATAGAGGG - Intergenic
944418342 2:199501417-199501439 AGATTAATGGAACAAAAATAGGG - Intergenic
947852062 2:233296369-233296391 AGACTACTCGAACACTTATTTGG - Intergenic
1170099560 20:12683886-12683908 ATAATAATTTAACACACATAAGG - Intergenic
1173861077 20:46284009-46284031 AGACTAATCTTTCACACTTAAGG + Intronic
1177189649 21:17836262-17836284 AGACTAGTAGAACACACAAATGG - Intergenic
1178018277 21:28377583-28377605 AAACTAATAGATCACAGATAGGG + Intergenic
1178062952 21:28872354-28872376 AGACTAAGCGCCCACACATGGGG - Exonic
949280386 3:2340015-2340037 AGAATATTTGGACACACATAGGG - Intronic
962903489 3:139780763-139780785 AAACTAATCCAACACTAATAAGG - Intergenic
966035935 3:175414352-175414374 AGAGGAATTAAACACACATAAGG - Intronic
967843676 3:194027804-194027826 AAACTTATCTAACACACAAATGG - Intergenic
972186658 4:36536511-36536533 AGACTACCCGAACTCACACAAGG - Intergenic
988331029 5:29840136-29840158 AGATTATTGAAACACACATATGG + Intergenic
991533310 5:67638722-67638744 AGACAGATCAAACTCACATATGG - Intergenic
992267428 5:75032850-75032872 AGACTAATCAATCCCAAATAGGG + Intergenic
995294975 5:110509718-110509740 AGAAATATCGTACACACATATGG + Intronic
996707687 5:126513648-126513670 AAATTAATCGAACACAAAGAAGG + Intergenic
998637238 5:143969535-143969557 AGACTAAGAGAACAAAGATATGG + Intergenic
1001162159 5:169329496-169329518 AGACTAGTCAAACTAACATATGG - Intergenic
1004260696 6:14104975-14104997 AGACAAACCAAACACACCTATGG - Intergenic
1004872200 6:19917888-19917910 AGACTAATCTAAAATTCATATGG + Intergenic
1009024602 6:57983679-57983701 AGAATAGTAGAACACACACACGG + Intergenic
1009200185 6:60735151-60735173 AGAATAGTAGAACACACACACGG + Intergenic
1013693285 6:112670142-112670164 AGACTAAGAGATCAGACATATGG - Intergenic
1021780034 7:24095251-24095273 AGACCAATGGAACAGAAATAAGG - Intergenic
1024253981 7:47526361-47526383 AGGCTAACCAAACACACATGCGG + Intronic
1030820609 7:114086989-114087011 AGAGTAAACAAACACACATCTGG - Intronic
1036656468 8:10680480-10680502 AGACTCATCAAACAGACAGAAGG + Intronic
1037411151 8:18599245-18599267 AGACAAATTCAACACATATATGG + Intronic
1039763684 8:40606063-40606085 AGACTAATCGAACACACATAAGG - Intronic
1061041144 9:128141314-128141336 AGACTAATCGAATAGAAATTTGG - Intergenic
1194027878 X:88776519-88776541 AGACCAATGGAACAGAAATAAGG - Intergenic
1194263208 X:91723576-91723598 AGACTTTTCTAACACACACAAGG + Intergenic
1194419186 X:93650826-93650848 GGACTAATAGAACATACAAATGG + Intergenic
1197789533 X:130239522-130239544 AGACTTGTCGAATATACATATGG - Intronic
1198745461 X:139885536-139885558 TGACTTATAAAACACACATATGG + Intronic