ID: 1039763685

View in Genome Browser
Species Human (GRCh38)
Location 8:40606077-40606099
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039763682_1039763685 15 Left 1039763682 8:40606039-40606061 CCTTTACCTTCAGTTTATGTGAG 0: 4
1: 327
2: 470
3: 415
4: 820
Right 1039763685 8:40606077-40606099 GATTAGTCTCTTGAAGACAGTGG No data
1039763683_1039763685 9 Left 1039763683 8:40606045-40606067 CCTTCAGTTTATGTGAGTCCTTA 0: 4
1: 293
2: 418
3: 321
4: 406
Right 1039763685 8:40606077-40606099 GATTAGTCTCTTGAAGACAGTGG No data
1039763680_1039763685 17 Left 1039763680 8:40606037-40606059 CCCCTTTACCTTCAGTTTATGTG 0: 5
1: 279
2: 453
3: 421
4: 541
Right 1039763685 8:40606077-40606099 GATTAGTCTCTTGAAGACAGTGG No data
1039763681_1039763685 16 Left 1039763681 8:40606038-40606060 CCCTTTACCTTCAGTTTATGTGA 0: 5
1: 338
2: 491
3: 463
4: 993
Right 1039763685 8:40606077-40606099 GATTAGTCTCTTGAAGACAGTGG No data
1039763684_1039763685 -9 Left 1039763684 8:40606063-40606085 CCTTATGTGTGTTCGATTAGTCT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1039763685 8:40606077-40606099 GATTAGTCTCTTGAAGACAGTGG No data
1039763679_1039763685 20 Left 1039763679 8:40606034-40606056 CCACCCCTTTACCTTCAGTTTAT 0: 2
1: 205
2: 504
3: 539
4: 1032
Right 1039763685 8:40606077-40606099 GATTAGTCTCTTGAAGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr