ID: 1039765173

View in Genome Browser
Species Human (GRCh38)
Location 8:40620921-40620943
Sequence TTGGAAATGAATAAGCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039765173_1039765177 9 Left 1039765173 8:40620921-40620943 CCCTACTGCTTATTCATTTCCAA 0: 1
1: 0
2: 1
3: 25
4: 260
Right 1039765177 8:40620953-40620975 GGAAACTAGTAAAGTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039765173 Original CRISPR TTGGAAATGAATAAGCAGTA GGG (reversed) Intronic
906941808 1:50262067-50262089 TTGGAAATAATTAAACAGCAAGG + Intergenic
907152613 1:52303213-52303235 TTGGTAATGAATAGGTGGTAAGG - Intronic
908450388 1:64248531-64248553 TTAAAAATGAACAAGCATTAGGG + Intronic
909026244 1:70485633-70485655 CTGCAAATGAATGAGCAGTATGG + Intergenic
909440866 1:75694095-75694117 ATGGAAATGACCAAGCAGAAAGG + Intergenic
912641195 1:111347283-111347305 TTGGAAGTGAGGAAGGAGTAGGG - Intronic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
915074957 1:153300264-153300286 TGGGACATGGATAAGCAGTGGGG - Intronic
915147544 1:153803979-153804001 TTGGAAATAAATAACCAAAACGG + Intergenic
915805693 1:158846955-158846977 TTGGAAAAGAATAAGTAATGAGG + Intronic
915919954 1:159968743-159968765 ATGGAAATGGTTAAGAAGTAGGG + Intergenic
916492323 1:165312809-165312831 TTGCTAATGAATCTGCAGTAGGG - Intronic
918477265 1:184938261-184938283 ATGGAAATGAATAAGAAAGAAGG + Intronic
918763123 1:188440664-188440686 GTACAAATGAATAAGCAGAAAGG - Intergenic
919322508 1:196061091-196061113 GTGGAAATGATTAGGCAGCAGGG - Intergenic
920425302 1:205870324-205870346 CTGGAAAGGAATAAGCATTAGGG - Intergenic
921367463 1:214387107-214387129 TTGGAACTGGAGAAACAGTAAGG + Intronic
921699369 1:218250019-218250041 ATGAAGATGAATAAGCAGTGAGG + Intergenic
923242911 1:232102962-232102984 ATGGAACTTAAAAAGCAGTAAGG + Intergenic
1065968593 10:30788083-30788105 TTGGAAATTAATAACCTGAAGGG - Intergenic
1068394226 10:56440836-56440858 TTGGACAAGAAGAAGCAATATGG - Intergenic
1068663975 10:59653117-59653139 TTGGATAAGAATAAGCAGGCAGG + Intronic
1068916750 10:62441153-62441175 TAAGAAATGAATAACCAGTGAGG + Intronic
1069143156 10:64854018-64854040 TTGGAAAAAAATAAGGAATATGG - Intergenic
1069341767 10:67417969-67417991 TGGTAAATGGATAAGCAGCATGG + Intronic
1071344755 10:84682368-84682390 TTGGAAATGAAAGACAAGTATGG - Intergenic
1071905589 10:90170098-90170120 TTGGATAAGAATAAGAAATATGG + Intergenic
1073027204 10:100496701-100496723 TTGGTGATGTATAAGCAGAAAGG - Intronic
1073932775 10:108595264-108595286 TTGGCAATGATTATTCAGTAAGG - Intergenic
1074144752 10:110707462-110707484 TAGGAAATAAATCAGCAGAATGG - Intronic
1074545794 10:114401510-114401532 TTGGCGTTGTATAAGCAGTAAGG - Intronic
1076397013 10:130146617-130146639 TTAGAAATGAATTATCAGGAGGG + Intronic
1078423900 11:11234031-11234053 TTGGAAATGAATGCGAAGGAGGG - Intergenic
1079411089 11:20188379-20188401 TTGGAAATAAAAAGGCAGTTAGG - Intergenic
1079726021 11:23882270-23882292 TTGGATATGAAAAACCACTAAGG - Intergenic
1080282542 11:30574879-30574901 TTGGAACTGAATTTGCAGGAGGG - Intronic
1080343266 11:31294006-31294028 AGAGAAATGATTAAGCAGTATGG - Intronic
1080764991 11:35287746-35287768 TTGGAGACCAATAAACAGTAAGG + Intronic
1081051334 11:38345195-38345217 TTGGAAATGAGGAAGGAGCAAGG - Intergenic
1081227911 11:40547626-40547648 TTGGAAAAGCAAAAGCAATAAGG - Intronic
1081251859 11:40845849-40845871 TTGGCCATGATTAAACAGTAAGG - Intronic
1086067655 11:82763679-82763701 ATGGAAAGGAAAAACCAGTACGG - Intergenic
1087266537 11:96067797-96067819 TTGGGAATGTATAAGTAATATGG - Intronic
1088565617 11:111169606-111169628 TGGGAAATGAATAATCTCTATGG + Intergenic
1089225014 11:116911845-116911867 TTGCCAGTAAATAAGCAGTAAGG - Intronic
1089271776 11:117306505-117306527 TTGGAAAAGAGTAAGTGGTAGGG + Intronic
1092832693 12:12460446-12460468 TTAGAAAGGAATAAGCAAAAGGG - Intronic
1093089205 12:14902851-14902873 TAAGAAATGAATAAGGAATAGGG - Intronic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093725234 12:22499692-22499714 TTGGAAGTGCATAAGAATTAGGG - Intronic
1093807607 12:23453966-23453988 TTAAAAATGAATCAGCAGCAGGG + Intergenic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1093984204 12:25510651-25510673 CTAGAAAAAAATAAGCAGTAAGG - Intronic
1095134767 12:38586787-38586809 TTAAAAATGAATAAGCACTTAGG - Intergenic
1096445332 12:51685522-51685544 ATGGAAATGAAATGGCAGTATGG + Intronic
1097763827 12:63499999-63500021 ATGGAAATGAAAAAGCTGTTGGG - Intergenic
1098421036 12:70298306-70298328 TTGTAAAGGGAAAAGCAGTAAGG - Intronic
1101430852 12:104625792-104625814 TTGGAAATGAAAAAGAAGACAGG - Intronic
1107714413 13:43185448-43185470 TTGGAAATCACTAAGAAGAAGGG - Intergenic
1108012638 13:46035515-46035537 TTGGTAATGAATATGTAGTACGG - Intronic
1109447211 13:62457041-62457063 TTGAAATAGAATAACCAGTAGGG + Intergenic
1110708632 13:78625566-78625588 ATGCTAATGACTAAGCAGTAAGG - Intronic
1111208076 13:85038789-85038811 AAGGAAATGAATATGCATTAAGG + Intergenic
1111663587 13:91240945-91240967 TTGCAAATGAAAATACAGTAGGG + Intergenic
1113129881 13:107023871-107023893 TTGTAACTGAATAATCATTAAGG - Intergenic
1113130008 13:107025604-107025626 TTGTAACTGAATAATCATTAAGG + Intergenic
1115020843 14:28679744-28679766 TTTGATATAAATAACCAGTAAGG + Intergenic
1115109225 14:29801436-29801458 ATGAACATGAATAAGCAGTAGGG + Intronic
1116160480 14:41261436-41261458 TTGGAGATGAATGTGTAGTAAGG + Intergenic
1116785129 14:49279889-49279911 TTGGAAATTAATCAGATGTATGG + Intergenic
1117033724 14:51704876-51704898 TTCAAAAGGAATAAGCACTATGG + Exonic
1118489972 14:66249394-66249416 GTGGAGATGAATATGCAGTCAGG - Intergenic
1119346535 14:73929435-73929457 TTGGAGATCACCAAGCAGTATGG + Intronic
1120786777 14:88545287-88545309 TTAGTAATTTATAAGCAGTAAGG - Intronic
1124079063 15:26474582-26474604 TGGGAAATGAAGAAGCTGAAAGG - Intergenic
1125183648 15:36906380-36906402 GTAGAAATGAAAAAGAAGTAGGG + Intronic
1125988303 15:44078020-44078042 TTGTAAATGAATAAGCTTTGGGG - Intronic
1129209089 15:74055854-74055876 TAGGAGATGACTAAGCTGTAAGG + Intergenic
1129404493 15:75306412-75306434 TAGGAGATGACTAAGCTGTAAGG - Intergenic
1129478102 15:75800917-75800939 TAGGAGATGACTAAGCTGTAAGG - Intergenic
1130865136 15:87927022-87927044 TTGGAAATGAATAAAAAATATGG + Intronic
1131926619 15:97391622-97391644 TAAGAAATGAATAAGCAGGCCGG + Intergenic
1133540908 16:6752749-6752771 ATGGAAGTGAAGAAGCAGTAAGG - Intronic
1134894748 16:17874861-17874883 TTGGAAATTAAAAATCAGAAAGG - Intergenic
1136031362 16:27505658-27505680 TTGGAAATGAATAAGCCACTGGG + Intronic
1137379885 16:47987342-47987364 CTGGAAATGACTAAGAAATAGGG + Intergenic
1138861036 16:60757749-60757771 TTGGAAATGAGGGAGCATTAGGG - Intergenic
1141327599 16:83076675-83076697 TTTGAAATGCATAAAAAGTAAGG - Intronic
1146502785 17:33378673-33378695 TTGGAAATGAACTGGCAGGAAGG + Intronic
1147512525 17:41083718-41083740 TTGGAAAGGAATTAGAAGGAAGG - Intergenic
1147514690 17:41104900-41104922 TTGGAAAGGAATTAGAAGGAAGG - Intronic
1149194010 17:54097938-54097960 TTGAAAATGAATAAGTATAAAGG - Intergenic
1149947844 17:60950228-60950250 TTTGAAATGATCTAGCAGTAGGG + Intronic
1151843501 17:76634559-76634581 TTGGAAAAGAAAAAGCAGAATGG - Intronic
1153365697 18:4253278-4253300 TTACAAAAGAATAAGCAGTGGGG + Intronic
1155193245 18:23449939-23449961 TTGCAAATGAACAAACTGTATGG - Intergenic
1156366209 18:36429648-36429670 AAGGAAATGAATATGCAGAACGG + Intronic
1157145033 18:45153602-45153624 TTGGAAATGAATAACAAATAAGG - Intergenic
1157268322 18:46248526-46248548 TGGAAAAGGAAAAAGCAGTAAGG - Intronic
1158531256 18:58264029-58264051 GTGGAAAAGCATAATCAGTAAGG - Intronic
1159318662 18:66816020-66816042 GTGGAAATAGATAAGCAGGAAGG + Intergenic
1159474502 18:68902399-68902421 TAGGAAATCAAAAAGCAGCATGG + Intronic
1160567477 18:79796160-79796182 TGGGAAATGAATCAGCAGGGTGG + Intergenic
1166256678 19:41611142-41611164 TATGAAATGGAGAAGCAGTATGG + Intronic
1167222789 19:48213789-48213811 TTGGGAATGAATAGGAAGTGGGG - Intronic
1167567339 19:50264910-50264932 TTGGAAAGGAATGAGAAGGATGG + Intronic
1168663473 19:58184813-58184835 TTTCAAATGAATAAGAAATAGGG + Intronic
926134322 2:10325921-10325943 TGGGAAATGAGGAAGCAGTTGGG + Intronic
927611643 2:24547625-24547647 TTGCAAATGCATAATCAGTGAGG + Intronic
931120063 2:59206604-59206626 TTGGAAATGACAAAGAAGAATGG + Intergenic
932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG + Intergenic
932287614 2:70550125-70550147 TAGGAAATGAAGTAGCATTAAGG - Intronic
932697664 2:73970208-73970230 TTATGAATGAATAAGCAGCATGG + Intergenic
932702403 2:74000912-74000934 TTGGAAAGGAACAACTAGTACGG - Intronic
934634022 2:95965577-95965599 TTAGAAATGAAACAGAAGTATGG - Intronic
934799607 2:97139658-97139680 TTAGAAATGAAACAGAAGTATGG + Intronic
936233898 2:110726595-110726617 TTGGAAATGAGGAAACAGCAAGG + Intergenic
936405650 2:112200270-112200292 TTGGAAATAACAAAGGAGTATGG + Intergenic
936676639 2:114723311-114723333 TTGGGAATGAATAAGCACTGTGG + Intronic
936687072 2:114840273-114840295 TTTGAAAGGAAGAAGGAGTAAGG + Intronic
939011153 2:136847298-136847320 ATGGAAGTGAATATGCATTAAGG + Intronic
940134307 2:150418592-150418614 TTGGAATGGAAGAAACAGTAAGG + Intergenic
940440224 2:153706538-153706560 CTGGAAATGATTGAGGAGTAGGG - Intergenic
940473998 2:154137108-154137130 ATGGGAAAGAATAAGCAGTTGGG - Intronic
940807301 2:158202335-158202357 GTGGAAGTGAATAGGCAGAAAGG + Intronic
941428211 2:165377180-165377202 TTAGAAAAGAATAAGTAGAAAGG + Intronic
942830702 2:180235290-180235312 CTGGAAAGGAATAAGCATTAGGG + Intergenic
945131325 2:206575879-206575901 ATGGAAGTGAGTAAGGAGTAGGG + Intronic
946959471 2:224968624-224968646 TTGGGAAGGTAAAAGCAGTAAGG - Intronic
1169614576 20:7425797-7425819 TTGGGAATGAAGAAGTAGAAGGG - Intergenic
1170127524 20:12981706-12981728 TTGAAAATGATTAAGATGTAGGG - Intergenic
1170872127 20:20215499-20215521 TTTGGAAGGAATAAGTAGTAGGG + Intronic
1173305593 20:41845032-41845054 TGGGAAATGAGAAAGCAGTGAGG - Intergenic
1173573129 20:44091091-44091113 TTGGAAGTGAACAAGCTGGAAGG + Intergenic
1174243882 20:49161528-49161550 TTATAAATGCACAAGCAGTATGG + Intronic
1174317981 20:49717436-49717458 TTGGAGATGAAAAAGTAGTGTGG - Intergenic
1175099946 20:56571969-56571991 TGAGATATGAATAAGCAATACGG - Intergenic
1175396859 20:58670757-58670779 TTGGAAAGGAAGAAACAGTACGG - Intronic
1175592164 20:60201796-60201818 TTCCAATTGAATAGGCAGTAGGG - Intergenic
1177110476 21:17021415-17021437 TTGGAGTTTAATTAGCAGTATGG - Intergenic
1178129809 21:29559498-29559520 TTGGAAATAAAGAAGCAAGAAGG + Intronic
1184303817 22:43580705-43580727 TGTTGAATGAATAAGCAGTAGGG - Intronic
1184577998 22:45389376-45389398 TAGGAAATGGATAAGACGTATGG - Intronic
950933765 3:16817835-16817857 TTGGAAATCAATAAGGAAGAAGG - Intronic
951634590 3:24759216-24759238 ATGTAAATAAATGAGCAGTATGG - Intergenic
951698209 3:25467928-25467950 TTGGAAAACAATAAACAGAATGG + Intronic
952734862 3:36679535-36679557 TTCTAAATGACTAAGCAGTAGGG + Intergenic
952769550 3:36985632-36985654 TGGGAAATGAAAAAAGAGTATGG - Intergenic
952924545 3:38311459-38311481 TGGAAAATGAATAAACAGCATGG + Intronic
953349621 3:42205613-42205635 TTGGTTATGATTAAGCAGAAAGG - Intronic
954289213 3:49640420-49640442 TTGGGAAAGAATAAGCACTATGG + Intronic
955551352 3:60088423-60088445 TTGGAAAGAAGTAAGCAGCATGG - Intronic
956577914 3:70775880-70775902 TTTAAAATGAATCAGCAGTTGGG + Intergenic
957224923 3:77430961-77430983 TGGGAAAAGAATAAGCAGATTGG - Intronic
957720234 3:83986217-83986239 TTGTAAATAAGTAAGCAGTCTGG + Intergenic
957912276 3:86635541-86635563 TTGGAAATGTATTAGGACTAAGG - Intergenic
958109766 3:89126394-89126416 TTACAAATGAATATTCAGTATGG + Intronic
958629959 3:96672047-96672069 CTGGAAAGGAATAAGCATTAGGG - Intergenic
958795937 3:98706361-98706383 TTGGAATTGAATCAGCAATTAGG + Intergenic
959432725 3:106274726-106274748 TTGGAAATGAAAAACAAGTCTGG - Intergenic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
962421359 3:135231942-135231964 CTGGAAAGAAATAAGCAGCAGGG + Intronic
962493195 3:135914031-135914053 TTGGGAATGAACAGGCAGGAAGG - Intergenic
966520747 3:180870892-180870914 TTGCAAATGCATGATCAGTAAGG + Intronic
966780539 3:183580314-183580336 TGGGAAATTAATAAGCTGTATGG + Intergenic
966810853 3:183843304-183843326 TTAGAAAAAAATAAGCAGTCTGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
971810842 4:31424999-31425021 GTGGAAATGAATGTACAGTATGG + Intergenic
972694388 4:41430922-41430944 TTGGAAATAAACCAGCATTATGG + Intronic
973157453 4:46974736-46974758 TTGGAAGTGAGTTAGAAGTACGG - Intronic
975372091 4:73600750-73600772 TGGGAAATGAACCAACAGTATGG - Intronic
976061509 4:81133726-81133748 TGGCAAATGAATTAGCAGAATGG + Intronic
976145783 4:82041920-82041942 TTGGAAATGAATATTTAGAAAGG + Intronic
976430763 4:84961524-84961546 TTGTAAAGGAATAATCATTAGGG - Intronic
977391688 4:96417888-96417910 ATTGAAATGAATAAAAAGTAAGG + Intergenic
977608851 4:99012160-99012182 TTAGAAATTAATAGGCAATAAGG - Intronic
978467638 4:109026405-109026427 TTGTAATTGATTAAGCAGTGAGG + Intronic
978470297 4:109058894-109058916 TGGAAAATGAATAAACAGAAAGG + Intronic
978707217 4:111728194-111728216 TGAGAAATAAATAAGCATTAGGG - Intergenic
978983253 4:114978329-114978351 TTGTAAAGGAATAAACAGTTAGG - Intronic
979939150 4:126738119-126738141 TAGAAATAGAATAAGCAGTAAGG + Intergenic
980684871 4:136214226-136214248 TTTGAGATGATCAAGCAGTAAGG + Intergenic
981464996 4:145057818-145057840 TAGGATTTGAATAAGCAGAAAGG - Intronic
981872288 4:149501139-149501161 TTGGAAATGCAGAAGCAATCAGG - Intergenic
982558280 4:156897125-156897147 TTGGGGATGAAGAGGCAGTAAGG + Intronic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
983485509 4:168327783-168327805 ATGGAAAAGAAAAAGCAGTTTGG + Intergenic
984279359 4:177650318-177650340 TAGGAAATGACTAAGAAGTAAGG - Intergenic
984357027 4:178674277-178674299 TTAGAAATGAAGAAGTAATAAGG + Intergenic
984825295 4:183918957-183918979 TTGCAAATGAATAAGTAACATGG - Intronic
985117572 4:186606641-186606663 TTGGAAATGAGTCAGCGCTAAGG - Intronic
986302373 5:6488167-6488189 GTGGAATTGACTAAGCACTAGGG + Intronic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
988692618 5:33588014-33588036 TTGGAAATCAGTAAGCTGGAAGG - Intronic
988933193 5:36057177-36057199 TTGCAAATAAATAAACAGTATGG + Intronic
990940615 5:61199875-61199897 TTGGAGAAGAATAAGCACTCTGG + Intergenic
991917590 5:71620346-71620368 TTTGAATTGAAAAAGAAGTAAGG + Intronic
992956943 5:81919796-81919818 ATGGAAAACAATATGCAGTATGG - Intergenic
993970682 5:94416106-94416128 TTGGGAAGCAAGAAGCAGTAAGG + Intronic
994083670 5:95735099-95735121 TTGGAACTGAATGAGCTGTGTGG + Intronic
994182169 5:96779503-96779525 TTGGAAATGAAAAAGAATGAAGG - Intronic
994305544 5:98199636-98199658 TTGCAAATGAATTAACAGTAAGG + Intergenic
996289832 5:121839689-121839711 ATGGAAAAGAAGAAGCAGCATGG + Intergenic
997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG + Intronic
997832496 5:137162952-137162974 TTGGGAATGGAGAAGCAGAAAGG + Intronic
998247993 5:140526380-140526402 TTGGGAATGAAGGAGCAGTGAGG - Exonic
998765131 5:145478083-145478105 ATGGAAATGAACAAGTAGAAAGG - Intronic
998872879 5:146570159-146570181 TTGGAAATTTATGAGCAATAAGG + Intergenic
998989609 5:147801341-147801363 TTGGAAATGAAAAAGTAGAGAGG - Intergenic
999074963 5:148786788-148786810 CTGGAATAGAAAAAGCAGTAGGG + Intergenic
1001657779 5:173365719-173365741 TTAAAAGTGAATAAGCAATAAGG - Intergenic
1004126840 6:12882285-12882307 TTGGAGATGATTAAGAAATAGGG + Intronic
1004241908 6:13931270-13931292 TTGGAAATGAACAAGGACAAGGG + Intronic
1005439412 6:25849704-25849726 TAGGAAATGAATAAACCATAGGG - Intronic
1005772501 6:29088934-29088956 ATGGACATAAATAAGCAGTTTGG + Intergenic
1007137067 6:39532718-39532740 CTGGAAATAATTAAGCAGTATGG - Intronic
1010641409 6:78332639-78332661 TTGGAAAGTAATAAGTACTAAGG - Intergenic
1011450542 6:87487262-87487284 TTGAGAATGAATTAGAAGTAGGG + Intronic
1012193925 6:96316076-96316098 TTGGAAATGAGAAAGCACTCTGG - Intergenic
1013668403 6:112371839-112371861 TTGTCAATGAAGAATCAGTAGGG - Intergenic
1015008210 6:128310566-128310588 ATGGCAATGAAAAAGCAGAAAGG + Intronic
1016781079 6:147959168-147959190 TTGGAAATGAAGAAAGGGTAGGG - Intergenic
1017526552 6:155246265-155246287 GTGGACATGAATGAGCACTAAGG - Intronic
1018589000 6:165395725-165395747 TTAGACTTGAATAAACAGTATGG + Intronic
1018878829 6:167853880-167853902 TTGAAAATGATCCAGCAGTAGGG - Intronic
1019943816 7:4311196-4311218 TTGGAAAGGCAGAAGCAGTTGGG - Intergenic
1021345601 7:19524448-19524470 CTGAAAATGAAGAAGCAGAAAGG + Intergenic
1021720189 7:23497314-23497336 TTAGAAATGAATAAACAATCAGG - Intergenic
1023008621 7:35904258-35904280 TTGGAAAAGAACAAGAAGAAAGG + Exonic
1023016550 7:35973629-35973651 TTGGAAAAGAACAAGAAGAAAGG + Intergenic
1023230631 7:38024272-38024294 CTGGAGATGAGTAAGCAGGAGGG + Intronic
1023282258 7:38583091-38583113 TTGAAAATGAATAAGCGGGATGG - Intronic
1026097731 7:67359959-67359981 GTGGAAATGAAGAAGCCATAAGG + Intergenic
1026592061 7:71705633-71705655 TTGAAAATGAATAAACAAAATGG + Intronic
1028672622 7:93420610-93420632 TTGGTAATTAAAAAGCAATATGG - Intergenic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1029804443 7:102981775-102981797 TTGGAAATGATTAAGCCATGAGG - Intronic
1030740890 7:113108583-113108605 TTGAAAATGAAGAAGTAGTTTGG + Intergenic
1030796594 7:113796278-113796300 TTGGGTATGAATAGGCAGTGGGG - Intergenic
1031673052 7:124575379-124575401 ATGGAAATGAATAAACTGCAAGG + Intergenic
1034611006 7:152368626-152368648 TTGGAAAAGAACAAGAAGAAAGG + Intronic
1035995736 8:4544853-4544875 CTGGAATTGAATAAGCAGCAAGG + Intronic
1038416414 8:27399498-27399520 TTGGAAATGGACAGGCACTAGGG + Intronic
1038489869 8:27963077-27963099 GTGGAAATGAAACAGCAGAAAGG - Intronic
1039651317 8:39341960-39341982 TTGGAACTGAATAATGGGTAGGG - Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1042463533 8:69099494-69099516 TTAGAACTGAAAAATCAGTACGG + Intergenic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1043058567 8:75471600-75471622 TTGGAAATTAATAAGAAGGAAGG - Intronic
1043291468 8:78606800-78606822 TTGCAAAAGAATAAGAAATAAGG - Intergenic
1043510016 8:80941089-80941111 TTGGAAATTAATAAGGAACAAGG + Intergenic
1043594352 8:81866413-81866435 TTGTAAATGAATAAAAATTAAGG + Intergenic
1044261127 8:90123263-90123285 TAGGAAATTAATAATCAGTTTGG + Intergenic
1044291305 8:90473668-90473690 TTGGAAATAAATAAGCTATTTGG + Intergenic
1044570124 8:93708911-93708933 TTGGAAATGACTAAGGAGAGTGG - Intronic
1045475886 8:102551884-102551906 TTGGAATAGCACAAGCAGTACGG - Exonic
1047176410 8:122545132-122545154 CTGGAAGTGATTCAGCAGTAAGG + Intergenic
1049153328 8:141050519-141050541 TTGAAAATGAACAAGAAATAAGG + Intergenic
1050689510 9:8209466-8209488 TTGAAAATGAATGAGAAATATGG - Intergenic
1051004874 9:12331455-12331477 TTGGAAATGGATAAATTGTACGG + Intergenic
1055045985 9:71924230-71924252 TTGGAAAAGAATTAGGACTAAGG - Intronic
1057856859 9:98608099-98608121 TTGGAAAAGAACAAGAAGAAAGG + Intronic
1058141005 9:101356874-101356896 TTGGAAGTGATTAAGCCATATGG - Intergenic
1058388020 9:104461407-104461429 TTGGAAATAAAAAAGAACTATGG - Intergenic
1059983125 9:119795049-119795071 TTGGAACTGAATAAAAAATATGG + Intergenic
1186025057 X:5300355-5300377 GTGGAAATGATCAAGCAGAAAGG + Intergenic
1186909869 X:14151509-14151531 GTGGAAATGAAGACGCAGTATGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187022546 X:15399223-15399245 TTGGAGCTGAATAATCAATAAGG + Intronic
1187386817 X:18856629-18856651 AAGGAAATGAAAAAGCAGAAGGG - Intergenic
1187637905 X:21252983-21253005 TTGGAAAAGAAACAGCAGGATGG - Intergenic
1188292206 X:28403071-28403093 TTGGAAGAGAATATGCAATAAGG + Intergenic
1188373283 X:29395260-29395282 ATGTACATGAATAAGCAGTTGGG + Intronic
1188408971 X:29847941-29847963 TTTTAAAAGAATAAGCAGAATGG - Intronic
1188759215 X:34004901-34004923 TTGAATTTGAATAAGCATTATGG + Intergenic
1189602187 X:42639056-42639078 TAGGCAATGATTAAGAAGTAAGG - Intergenic
1190566482 X:51735006-51735028 TTGAAAATGGTGAAGCAGTATGG + Intergenic
1192635320 X:72810227-72810249 TTGGAAAAGAACAAGCATGAAGG - Intronic
1192646394 X:72910576-72910598 TTGGAAAAGAACAAGCATGAAGG + Intronic
1192749132 X:73969979-73970001 ATGGAAAAGAATAAGCAGTCCGG - Intergenic
1194708879 X:97208996-97209018 TTAGAAATGATTATGTAGTAAGG - Intronic
1195011127 X:100733021-100733043 TAAGAAATGAATGAGAAGTAAGG - Intergenic
1195521110 X:105830496-105830518 ATAAAAAAGAATAAGCAGTATGG - Intronic
1195954618 X:110316993-110317015 TTGGATAAAAATAAGTAGTAAGG + Intronic
1197622088 X:128762292-128762314 TTGGAAATGAATTTGCAACATGG - Intergenic
1199026194 X:142941882-142941904 TTGGAAATAAATAGACAGTTTGG + Intergenic
1200769452 Y:7110042-7110064 TTTGAAATGAAAGAGCTGTAAGG + Intergenic