ID: 1039768328

View in Genome Browser
Species Human (GRCh38)
Location 8:40655327-40655349
Sequence TTTTGTGTTCATAAATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039768325_1039768328 22 Left 1039768325 8:40655282-40655304 CCTATAACATATTGTTGAAAGAA 0: 1
1: 1
2: 10
3: 64
4: 548
Right 1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG No data
1039768326_1039768328 -3 Left 1039768326 8:40655307-40655329 CCTAAATAAATGAAAAGTCATTT 0: 1
1: 3
2: 35
3: 250
4: 1484
Right 1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039768328 Original CRISPR TTTTGTGTTCATAAATTGGA AGG Intronic
No off target data available for this crispr