ID: 1039768627 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:40659727-40659749 |
Sequence | AGAAACGAAGGTGTTGGGAT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1039768627_1039768635 | 20 | Left | 1039768627 | 8:40659727-40659749 | CCTATCCCAACACCTTCGTTTCT | No data | ||
Right | 1039768635 | 8:40659770-40659792 | AGAGATGAAGCAACTCATCAAGG | No data | ||||
1039768627_1039768632 | -8 | Left | 1039768627 | 8:40659727-40659749 | CCTATCCCAACACCTTCGTTTCT | No data | ||
Right | 1039768632 | 8:40659742-40659764 | TCGTTTCTGAGAGGAGACTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1039768627 | Original CRISPR | AGAAACGAAGGTGTTGGGAT AGG (reversed) | Intronic | ||