ID: 1039768632

View in Genome Browser
Species Human (GRCh38)
Location 8:40659742-40659764
Sequence TCGTTTCTGAGAGGAGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039768627_1039768632 -8 Left 1039768627 8:40659727-40659749 CCTATCCCAACACCTTCGTTTCT No data
Right 1039768632 8:40659742-40659764 TCGTTTCTGAGAGGAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039768632 Original CRISPR TCGTTTCTGAGAGGAGACTG AGG Intronic