ID: 1039768635

View in Genome Browser
Species Human (GRCh38)
Location 8:40659770-40659792
Sequence AGAGATGAAGCAACTCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039768628_1039768635 15 Left 1039768628 8:40659732-40659754 CCCAACACCTTCGTTTCTGAGAG No data
Right 1039768635 8:40659770-40659792 AGAGATGAAGCAACTCATCAAGG No data
1039768629_1039768635 14 Left 1039768629 8:40659733-40659755 CCAACACCTTCGTTTCTGAGAGG No data
Right 1039768635 8:40659770-40659792 AGAGATGAAGCAACTCATCAAGG No data
1039768631_1039768635 8 Left 1039768631 8:40659739-40659761 CCTTCGTTTCTGAGAGGAGACTG No data
Right 1039768635 8:40659770-40659792 AGAGATGAAGCAACTCATCAAGG No data
1039768627_1039768635 20 Left 1039768627 8:40659727-40659749 CCTATCCCAACACCTTCGTTTCT No data
Right 1039768635 8:40659770-40659792 AGAGATGAAGCAACTCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039768635 Original CRISPR AGAGATGAAGCAACTCATCA AGG Intronic