ID: 1039770716

View in Genome Browser
Species Human (GRCh38)
Location 8:40684330-40684352
Sequence CATGTTAAATGTGGGGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 285}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039770716_1039770723 0 Left 1039770716 8:40684330-40684352 CCTCAAACCCCACATTTAACATG 0: 1
1: 0
2: 0
3: 24
4: 285
Right 1039770723 8:40684353-40684375 GAGTTCCAAATGGACAACGTGGG No data
1039770716_1039770721 -10 Left 1039770716 8:40684330-40684352 CCTCAAACCCCACATTTAACATG 0: 1
1: 0
2: 0
3: 24
4: 285
Right 1039770721 8:40684343-40684365 ATTTAACATGGAGTTCCAAATGG No data
1039770716_1039770722 -1 Left 1039770716 8:40684330-40684352 CCTCAAACCCCACATTTAACATG 0: 1
1: 0
2: 0
3: 24
4: 285
Right 1039770722 8:40684352-40684374 GGAGTTCCAAATGGACAACGTGG No data
1039770716_1039770726 19 Left 1039770716 8:40684330-40684352 CCTCAAACCCCACATTTAACATG 0: 1
1: 0
2: 0
3: 24
4: 285
Right 1039770726 8:40684372-40684394 TGGGCTTCCCTGACAGGAACTGG No data
1039770716_1039770725 13 Left 1039770716 8:40684330-40684352 CCTCAAACCCCACATTTAACATG 0: 1
1: 0
2: 0
3: 24
4: 285
Right 1039770725 8:40684366-40684388 ACAACGTGGGCTTCCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039770716 Original CRISPR CATGTTAAATGTGGGGTTTG AGG (reversed) Intronic
900296503 1:1954327-1954349 CATGTGAAATGTGGCCCTTGTGG + Intronic
901376074 1:8840524-8840546 TATTTTCAAGGTGGGGTTTGTGG - Intergenic
901391144 1:8947102-8947124 CATTTTAAAAGTCTGGTTTGGGG - Intronic
902232862 1:15039221-15039243 CCTGTTAAATGGGGGGAATGGGG - Intronic
908531862 1:65041384-65041406 CATCTCAAATGTGGAGTCTGAGG + Intergenic
909728405 1:78864159-78864181 CATGGTCCATGTGGGGTGTGGGG + Intergenic
910496035 1:87828722-87828744 TATGTTGACTGTGAGGTTTGCGG + Intergenic
910586120 1:88881065-88881087 CCTGTTCAATGTAGGCTTTGTGG - Intronic
912304653 1:108554938-108554960 CATTTTAAATGTGGGCTTAGAGG - Intergenic
913463515 1:119115138-119115160 CATTTTAAATTTGGGACTTGGGG + Intronic
913960000 1:143332092-143332114 CATGTTAAAAGTGCATTTTGGGG - Intergenic
914054357 1:144157665-144157687 CATGTTAAAAGTGCATTTTGGGG - Intergenic
914124789 1:144808696-144808718 CATGTTAAAAGTGCATTTTGGGG + Intergenic
916096995 1:161360257-161360279 TTTGTTAAATGTGGGGCTGGGGG + Intronic
917609991 1:176679389-176679411 CATGTTAATTTTGGGGTATTTGG - Intronic
917671532 1:177278161-177278183 CATGTTCCATATGGGTTTTGTGG + Intronic
919610838 1:199743922-199743944 CATCTAAAATGTGGGATTTCTGG + Intergenic
920601502 1:207329288-207329310 CTTTTAAAATGTGGGGTTTGAGG + Intronic
922594989 1:226806783-226806805 AATGTTAAATTTAGGGTGTGAGG - Intergenic
1066569529 10:36755801-36755823 CATGTTTAAACTGGAGTTTGGGG - Intergenic
1067028407 10:42864150-42864172 CATGTTAAAAGTGCATTTTGGGG - Intergenic
1068638629 10:59376226-59376248 CAAGTTCAATGTGGGCTTTGTGG + Intergenic
1068946310 10:62733109-62733131 CATGTTAGCTGTGGAGTCTGTGG + Intergenic
1069241639 10:66147101-66147123 CTTGTTAAATCTGGGGTATGGGG + Intronic
1069611574 10:69776102-69776124 CATTTTGGATGTGGGGTTGGAGG + Intergenic
1069940741 10:71953663-71953685 TATGTTATGTGTGGGGTTTAGGG + Intergenic
1073410107 10:103334487-103334509 GATGCTAAATGTGGGGTGAGGGG - Intronic
1074188402 10:111115832-111115854 CGAGATAAATGAGGGGTTTGGGG + Intergenic
1079584728 11:22111758-22111780 CATTTTCAATTTTGGGTTTGGGG + Intergenic
1079643680 11:22836759-22836781 CATGGTAAATTTGGGGGTTAGGG + Intergenic
1079877814 11:25881827-25881849 CATCTTAAATATGGGATTTGGGG + Intergenic
1079918392 11:26399747-26399769 CATTTAAAATGTGTGGTTGGAGG - Intronic
1080174429 11:29344701-29344723 CATGTTGAAGGTGGGGCTGGTGG + Intergenic
1080555012 11:33407877-33407899 CATGAGGAATGTGGGGGTTGAGG - Intergenic
1081494612 11:43596189-43596211 TATGTAAAACGGGGGGTTTGAGG - Intronic
1084471711 11:69365367-69365389 CTTGAACAATGTGGGGTTTGGGG + Intronic
1085336839 11:75702792-75702814 CATGAAGAAAGTGGGGTTTGAGG + Intergenic
1085404821 11:76255488-76255510 CTTGCTGAATTTGGGGTTTGGGG - Intergenic
1085742046 11:79085811-79085833 CATGTAAAGTGTGGGGTTATGGG - Intronic
1086391535 11:86370142-86370164 TATGTTAAATGTCATGTTTGAGG - Intergenic
1086830069 11:91551167-91551189 CATCTTAAAATTGGGGTTTTTGG - Intergenic
1088408994 11:109512781-109512803 AATGTGAAATGTGGGGCCTGGGG - Intergenic
1088459973 11:110072531-110072553 GATGTGGAAGGTGGGGTTTGGGG - Intergenic
1088609510 11:111563833-111563855 AATGACAAAGGTGGGGTTTGGGG - Intergenic
1088984849 11:114896648-114896670 CATGTTGGACGTGGGGCTTGTGG + Intergenic
1090926283 11:131253353-131253375 CATGCTTACTGTGGTGTTTGGGG + Intergenic
1091661660 12:2388566-2388588 CATGGTTCATGTTGGGTTTGTGG + Intronic
1091661666 12:2388632-2388654 CATGGTCCATGTTGGGTTTGTGG + Intronic
1091661686 12:2388832-2388854 CATGGTCCATGTTGGGTTTGTGG + Intronic
1097101056 12:56589846-56589868 CATGTGGAATTTGGGGTTGGGGG + Exonic
1097623352 12:61968512-61968534 AATGCTGAATGTGGGGCTTGAGG - Intronic
1099647587 12:85379105-85379127 CATTTTAAAAATGGGGTTTAGGG + Intergenic
1099864896 12:88267745-88267767 CAGGTTAAATATGGGTTTGGTGG - Intergenic
1101089579 12:101271204-101271226 CATTTTAAATGAGGGATCTGAGG - Intergenic
1101617601 12:106353489-106353511 CCTATCTAATGTGGGGTTTGTGG - Intergenic
1102196085 12:111026019-111026041 CATGCTCAATGTGAGATTTGGGG + Intergenic
1104263421 12:127206553-127206575 CTTGTTAAATTTGTGGTTTTGGG + Intergenic
1104663219 12:130627444-130627466 CTTGTGAAATGTTTGGTTTGAGG - Intronic
1105886094 13:24642859-24642881 CATGGTAAATTTGGGGGTTAAGG - Intergenic
1106004688 13:25757754-25757776 CTTGAGAAATGAGGGGTTTGGGG - Intronic
1106734086 13:32571586-32571608 GATGTTAAGTTTGGGGATTGGGG - Intergenic
1107997528 13:45875385-45875407 CATGAGACATGTTGGGTTTGTGG + Intergenic
1108228056 13:48310032-48310054 CATGTTATTTTTGGGATTTGAGG + Intronic
1108786297 13:53905967-53905989 CATGTTAATTTTGGGGTATTTGG + Intergenic
1109126540 13:58525431-58525453 AATGTTAAATGTGGAGTTAATGG + Intergenic
1109206141 13:59485356-59485378 CAGGTGAAAAGTGGGTTTTGTGG + Intergenic
1109737962 13:66511604-66511626 AATGTTAAAGGTGGGCTTGGTGG + Intronic
1110419981 13:75296832-75296854 TCTGTAAAATGTGGGGGTTGAGG - Intronic
1112420062 13:99240507-99240529 AATATTAAATGTGGGGATAGAGG + Intronic
1112525926 13:100146787-100146809 GATTTTAAATGTGTAGTTTGTGG + Intronic
1113068161 13:106392581-106392603 AATGTTAAATGTGAGAGTTGGGG - Intergenic
1113552790 13:111206126-111206148 GATGTTAAATATCAGGTTTGTGG + Intronic
1113610368 13:111640500-111640522 CAGTTTAAATGTGAGGTATGTGG + Intronic
1113853907 13:113433651-113433673 CAGGTTAAGTGTGGGGTGGGGGG - Intronic
1115420578 14:33189794-33189816 CATGTTAAATCTAATGTTTGGGG - Intronic
1116153346 14:41170305-41170327 CATGTTTAATTTGGGGATGGAGG - Intergenic
1118075975 14:62299622-62299644 CAACTGAAATGTGGTGTTTGGGG + Intergenic
1119176110 14:72568646-72568668 CATTTTCCATGTGGGGTCTGGGG - Intergenic
1119901914 14:78268094-78268116 GATGTTTAATGAGGGGATTGAGG + Intronic
1119999879 14:79290743-79290765 CATGATAAATCTGGGATTTTAGG - Intronic
1120049296 14:79846445-79846467 CATTCTAAGTGTTGGGTTTGAGG - Intronic
1120569757 14:86102227-86102249 TATCTTAAATGTGTGTTTTGAGG + Intergenic
1120569767 14:86102484-86102506 TATCTTAAATGTGTGTTTTGGGG - Intergenic
1120569832 14:86103489-86103511 TATCTTAAATGTGTGTTTTGAGG - Intergenic
1121535476 14:94687645-94687667 CAGGTTCAATGTGTGTTTTGGGG - Intergenic
1121909760 14:97778107-97778129 CATGTAGAGTGTTGGGTTTGTGG + Intergenic
1123807483 15:23889447-23889469 CATAGTAAATGTGGGTTGTGAGG + Intergenic
1123827234 15:24094230-24094252 AATGTTACAGGAGGGGTTTGGGG - Intergenic
1124362802 15:29051165-29051187 CAAGTTATATGTGGTCTTTGAGG + Intronic
1125117935 15:36117667-36117689 CATGTTAGATGTGGTGAATGGGG + Intergenic
1125292481 15:38165175-38165197 CATGATAGGTGTAGGGTTTGGGG + Intergenic
1126267387 15:46770396-46770418 CATGGTAAATTTGGGGATTAAGG - Intergenic
1126532211 15:49723459-49723481 CATGGTGAATCTGGGATTTGGGG + Intergenic
1126563165 15:50067083-50067105 CTTGCTAAATGTGAGGTATGGGG - Intronic
1127134106 15:55901359-55901381 GATATTCAATGTGGGGCTTGTGG + Intronic
1127187422 15:56493889-56493911 GATTTGATATGTGGGGTTTGGGG - Intergenic
1127341773 15:58053207-58053229 CATTTTAAATGTGGCATTTTAGG - Intronic
1127664327 15:61130335-61130357 CATGTGAAATGAGAGGGTTGTGG - Intronic
1129290518 15:74563471-74563493 CATTTAAAATGTGTTGTTTGGGG + Intronic
1129608099 15:77034599-77034621 CATGGCACAGGTGGGGTTTGTGG - Intronic
1129738476 15:77978530-77978552 CATGTATAAAGTGGGGTTTGGGG - Intergenic
1129866976 15:78916409-78916431 CATGTTAATTGTGGGGGCTCAGG - Intergenic
1131405227 15:92158979-92159001 CATGTTAGATAGGGGATTTGGGG - Intronic
1131663876 15:94548549-94548571 CAGGTTTAATTTGAGGTTTGGGG + Intergenic
1131919324 15:97306281-97306303 CATGATAACTGTGGGGTTGAAGG - Intergenic
1133422619 16:5659634-5659656 CATTTTAAACCTGGGGTTAGTGG + Intergenic
1135104425 16:19635393-19635415 AATGATATATGTGGGGTTTTTGG - Intronic
1138925410 16:61584225-61584247 CATTTTAACTGTGGGGTTTTTGG + Intergenic
1139029094 16:62857504-62857526 CATGTGAAATGTAGGATTTTGGG - Intergenic
1141451302 16:84105169-84105191 AATAATAAATGTGGGGTATGTGG + Intronic
1141707230 16:85673397-85673419 CATTTTTAATATGTGGTTTGGGG + Exonic
1142317732 16:89359204-89359226 CATGTTAAAGATGGTGTGTGTGG - Intronic
1146906639 17:36622247-36622269 GATGTTAGATTTGGGGTTTTGGG + Intergenic
1146913566 17:36663816-36663838 CTTCACAAATGTGGGGTTTGTGG + Intergenic
1149386637 17:56149211-56149233 CATGATGAAAGTGGTGTTTGGGG + Intronic
1152862367 17:82703694-82703716 CAGGTTTGAGGTGGGGTTTGGGG - Intergenic
1153136492 18:1923408-1923430 CATGGTAAATTTGGGGGTTAAGG - Intergenic
1154013253 18:10593669-10593691 CCTCTTACATTTGGGGTTTGTGG - Intergenic
1154152421 18:11916931-11916953 CCTCTTACATTTGGGGTTTGTGG - Intergenic
1155236042 18:23820144-23820166 TAGGTTAAACCTGGGGTTTGGGG + Intronic
1156203124 18:34856578-34856600 GCTGATATATGTGGGGTTTGGGG + Intronic
1157753923 18:50201416-50201438 CATCTTCAAATTGGGGTTTGTGG + Intergenic
1158174586 18:54640345-54640367 TAGGTTAAATGTTGGGTTGGAGG + Intergenic
1158482430 18:57833863-57833885 CATGTTCCATGTGGTGTTGGAGG + Intergenic
1158838721 18:61360167-61360189 CTTGTTAAATGTGGGTTTCCAGG - Intronic
1158839050 18:61364175-61364197 AAACTTAAATGTGAGGTTTGAGG - Intronic
1159187569 18:64996129-64996151 CATGTTAAATGTGAAGTTCAGGG - Intergenic
1159532151 18:69668547-69668569 CATGTTACTTTTGGGGATTGAGG + Intronic
1161751835 19:6103605-6103627 CATCATAAATGTGATGTTTGGGG + Intronic
1163806241 19:19399744-19399766 CACTATAAATGGGGGGTTTGGGG + Intronic
1166399920 19:42470887-42470909 CATTAAGAATGTGGGGTTTGGGG - Intergenic
1166823608 19:45595877-45595899 CATGTTAAAAATGGAGTTTAAGG + Intronic
1167143964 19:47671328-47671350 GATTTTATATGTGGGGTTTTTGG + Intronic
1202693836 1_KI270712v1_random:110343-110365 CATGTTAAAAGTGCATTTTGGGG - Intergenic
925540286 2:4959372-4959394 CCTGTAAAATGTGGGTTTGGGGG - Intergenic
927003480 2:18823841-18823863 CATTTTGAATGTGGGGCTTTGGG + Intergenic
928290208 2:30030012-30030034 CATGTTTAAAGTGGAGTGTGCGG + Intergenic
928963717 2:36956067-36956089 CATTTTGAATTTGGGGTTTTTGG + Intronic
929572904 2:43033836-43033858 CATGTTGAAGGTGGGGTAAGAGG - Intergenic
931354101 2:61518734-61518756 CAAGTGTAATGTGGGGTGTGAGG + Intronic
932111712 2:69007958-69007980 AATAATGAATGTGGGGTTTGAGG - Intergenic
932971320 2:76546667-76546689 CATGTTCAGTGTGGCATTTGTGG + Intergenic
933952726 2:87344232-87344254 CATGTTAAAAGTGCATTTTGGGG + Intergenic
934236968 2:90240578-90240600 CATGTTAAAAGTGCATTTTGGGG + Intergenic
936639022 2:114291725-114291747 CGTGTTAAAAGTTGGGGTTGGGG + Intergenic
937731343 2:125234441-125234463 CTTTTTAAATTTTGGGTTTGGGG + Intergenic
940649502 2:156427299-156427321 AATTTTAAATGTGGGGTCCGAGG - Intergenic
941094351 2:161218936-161218958 CATTTTAAATGTAGTGTTTGGGG + Intronic
941373447 2:164696910-164696932 CAAGTTAAATGTGAGCCTTGGGG + Intronic
941438950 2:165509316-165509338 CATGTAATATGTGGGGTAGGAGG + Intronic
942279464 2:174345230-174345252 TATGTTAAATGTTAGGTTAGGGG + Intergenic
943222623 2:185130323-185130345 CATGTTAAAAGTGTACTTTGGGG + Intergenic
945849072 2:214983840-214983862 CATGTTAACTGGGCTGTTTGGGG - Exonic
946213848 2:218168324-218168346 CATGGTAAATTTGGCATTTGTGG - Intergenic
946350621 2:219149183-219149205 CTTGTTAAAAATGGGGTGTGTGG - Intronic
946578106 2:221098215-221098237 CCTCTTAAAGATGGGGTTTGTGG + Intergenic
946868565 2:224065160-224065182 AATGATAAATGTGGAGTTTTAGG + Intergenic
948815247 2:240507282-240507304 CATGGGGAATGTGGGGTCTGGGG - Intronic
949008988 2:241667901-241667923 CATGTCAGAGGTGGGCTTTGGGG - Intronic
949046138 2:241873484-241873506 CATCTCAAAGGTGGGGTTGGGGG - Exonic
1168781308 20:493206-493228 CAGATTAAATGTGAGGTCTGAGG - Intronic
1170079330 20:12454654-12454676 TATGCTAAATGTGGGATTTTAGG + Intergenic
1173002920 20:39118382-39118404 CCTGTTCACTGTGGGCTTTGAGG - Intergenic
1173746066 20:45437951-45437973 CATGGTAAATCTGGGGGTTTAGG + Intergenic
1174427199 20:50440217-50440239 CATGTAAAATCTGGGAGTTGAGG + Intergenic
1174807303 20:53615813-53615835 CATGTTATGTGTTGGGTTTATGG - Intergenic
1174961269 20:55159817-55159839 TATGTTAGCTGTGGGTTTTGTGG + Intergenic
1176099631 20:63359083-63359105 GATCTGGAATGTGGGGTTTGGGG - Intronic
1177420446 21:20849848-20849870 AATGTTAAAAGTGGGGCCTGAGG - Intergenic
1177660352 21:24074665-24074687 CATATGACATGTGGGGATTGTGG - Intergenic
1177893862 21:26838490-26838512 TTTGATAAATGTGGTGTTTGCGG - Exonic
1181308473 22:21930584-21930606 CGTGGGAAAAGTGGGGTTTGAGG + Intronic
1182084991 22:27555370-27555392 CATTTTAAATGGGGAGATTGAGG - Intergenic
1182900391 22:33893800-33893822 ATGGTTAAACGTGGGGTTTGTGG - Intronic
952072113 3:29649901-29649923 CCAGTTTAATGTGGAGTTTGTGG - Intronic
952481628 3:33768033-33768055 TATATTAAATATGTGGTTTGTGG - Intergenic
952568022 3:34681516-34681538 CATGGTTAATGTGGCATTTGTGG + Intergenic
952661385 3:35853599-35853621 CTTGTCAGAAGTGGGGTTTGGGG - Intergenic
955495783 3:59530741-59530763 CATGGGAATTGTGGGGATTGTGG + Intergenic
955991426 3:64631864-64631886 AGAGATAAATGTGGGGTTTGTGG - Exonic
956881319 3:73513627-73513649 CATGTTAAATTCTTGGTTTGAGG - Intronic
956907340 3:73780444-73780466 TATTTTAGATTTGGGGTTTGAGG + Intergenic
957537188 3:81521771-81521793 AATGTTAAATTTGGGATTTTAGG + Intronic
959150717 3:102604076-102604098 AATGTTCAATGTGGTGTGTGTGG + Intergenic
959942652 3:112095772-112095794 CATGTTAGACGTGGGGGTGGGGG + Intronic
960624061 3:119663036-119663058 CATTTTAACAGTGGGGTTTGGGG + Intronic
960694539 3:120383256-120383278 AATGTTAGGTGTGGGTTTTGGGG + Intergenic
961254106 3:125532022-125532044 CTTGTAAAATGTGTGGTTTTTGG - Intronic
961322783 3:126089146-126089168 CATGGTAAATTTGGGGGTTGAGG + Intronic
962044224 3:131738589-131738611 GATTTTAAATATGGGGTTTTTGG + Intronic
963399431 3:144778952-144778974 CATGGTGTATGTGGGATTTGGGG + Intergenic
964552815 3:157903905-157903927 AATGTTGAAGGTGGGGCTTGTGG + Intergenic
965334550 3:167420155-167420177 AATGAGAAATGTGGGGATTGGGG + Intergenic
967690558 3:192468820-192468842 CATTATTAACGTGGGGTTTGCGG + Intronic
967796255 3:193601937-193601959 CAGGGTAACTGTTGGGTTTGTGG - Intronic
968261870 3:197331844-197331866 CAAATTAGATGTGGGGGTTGCGG + Intergenic
972031869 4:34470783-34470805 CAGGTTAAGGGTGGGATTTGTGG + Intergenic
972539976 4:40030840-40030862 CATAATAAATGTGTGGTTTTGGG - Intergenic
976719927 4:88159312-88159334 CAAGTTAAATGGGTGGTTTCTGG + Intronic
977146754 4:93451914-93451936 CATGTTAAATGTTAAATTTGAGG + Intronic
977561694 4:98539452-98539474 CATGTCAAAATTGTGGTTTGGGG - Intronic
977563233 4:98554905-98554927 CATGTTCAAGGTGGGGGTTGGGG + Intronic
977655879 4:99520071-99520093 AAAATTAAATGTGGGTTTTGGGG - Intronic
977919562 4:102627923-102627945 GATGTCTAATGTGGGGTTTCTGG - Intergenic
978728859 4:112001379-112001401 CATGTTAATTGTGGGTTTTCAGG - Intergenic
979356541 4:119712386-119712408 AAAGGAAAATGTGGGGTTTGAGG + Intergenic
980223505 4:129950378-129950400 CCTGTGAAATGTGGTGTCTGAGG + Intergenic
980663628 4:135899616-135899638 GAGGTGAAATGTGGGGTTGGTGG + Intergenic
980680367 4:136152392-136152414 CATGGTAAATGTGGGGGTGGGGG - Intergenic
983642879 4:169959746-169959768 CAGCTTAATTTTGGGGTTTGTGG + Intergenic
986395357 5:7323683-7323705 CATGTAAAATCTGTGGTGTGGGG + Intergenic
986657853 5:10032517-10032539 AATGTTTACTGAGGGGTTTGAGG - Intergenic
992145622 5:73844785-73844807 CATTTCAAATGTGTGTTTTGTGG - Intronic
992538701 5:77739939-77739961 CAAATTAAATGTGGGGCTAGGGG + Intronic
993198518 5:84782066-84782088 GAGGGGAAATGTGGGGTTTGAGG - Intergenic
995820892 5:116230965-116230987 CATCTTAATTGTGGGGAGTGGGG + Intronic
997049736 5:130365235-130365257 CATTTAAAATTTGGAGTTTGGGG + Intergenic
998993942 5:147850078-147850100 TATATTAAATGACGGGTTTGGGG - Intergenic
1001158896 5:169297088-169297110 CATGGTAAATGTTTGGTTTCAGG + Intronic
1004716377 6:18220133-18220155 CATTTTAAGTTTGGGGTTGGGGG - Intronic
1005651153 6:27886258-27886280 GATATTAAATGTGGCCTTTGGGG + Intergenic
1007059191 6:38921733-38921755 CTTGTTAATTGTGTGGTTTGGGG + Intronic
1007394114 6:41567604-41567626 AATTTTAAATGTAGGGGTTGGGG + Intronic
1008485256 6:52028375-52028397 CCTCTGACATGTGGGGTTTGTGG + Intronic
1009896694 6:69760490-69760512 CATATTAAGTGTGAAGTTTGAGG - Intronic
1010827428 6:80490139-80490161 CATGAGAAATGTGGGTTTTGTGG - Intergenic
1011773558 6:90702424-90702446 CATGAGAAATGTGGGGTAAGCGG - Intergenic
1012580286 6:100860415-100860437 CATGTAAATTGTGGGGTTGGGGG + Intronic
1014023278 6:116615951-116615973 CACGCTAAATGTGAGGCTTGGGG + Intergenic
1014169099 6:118258443-118258465 AATGTTAAATGAAGGCTTTGGGG - Intronic
1014363535 6:120510174-120510196 CATGTGACATGTGAGTTTTGTGG + Intergenic
1014804605 6:125814602-125814624 CATGATAAAAGTGGTATTTGAGG + Intronic
1014980781 6:127943772-127943794 CATGCTGACTGTGGGGTTTGTGG - Intergenic
1017217434 6:151925304-151925326 CATTTTAAAAGTGGGGTTTTGGG + Intronic
1017519356 6:155187876-155187898 CAAGTTAAAAATGGGGCTTGCGG - Intronic
1017716295 6:157216054-157216076 AATGTTAAATGTGGGGAGAGGGG - Intergenic
1017862666 6:158413486-158413508 CATGTTAAATTTGGGGCCTCTGG + Intronic
1018292868 6:162310584-162310606 CATGGTAATTGTGGGGTGGGGGG + Intronic
1020175559 7:5879263-5879285 CATGTTAGTTTTGGGGGTTGGGG + Intergenic
1021802706 7:24323793-24323815 CATGGTAATGGTGGGGATTGGGG - Intergenic
1021891705 7:25192776-25192798 TATGTAATATGTGGGTTTTGGGG - Intergenic
1022853990 7:34297756-34297778 CATGTCTAAAGTGGGGGTTGGGG - Intergenic
1024125674 7:46292037-46292059 CATGTGAAGTGTGGGGTTTATGG - Intergenic
1025480371 7:60975967-60975989 CATGTGCACTGTGAGGTTTGTGG - Intergenic
1026119235 7:67522221-67522243 CATGTTACATGTGTTGATTGGGG + Intergenic
1026210343 7:68298568-68298590 CTTTTAAAATGTGGGGTTAGAGG + Intergenic
1027200632 7:76061919-76061941 CATCTTAAATGTGGTTTGTGTGG - Intronic
1027578110 7:79956605-79956627 AATCTTAAATGTTGGGTTAGAGG + Intergenic
1028282908 7:88954663-88954685 CATTTAAAATGTGTGGTTTTGGG + Intronic
1028591787 7:92504609-92504631 TATGTTAAGTGTTGTGTTTGAGG - Intronic
1028812040 7:95098739-95098761 CAGGTAAAATTTGGGGCTTGAGG + Intronic
1028959881 7:96736751-96736773 CATGATAAAAGTGGTGTTTATGG + Intergenic
1029171612 7:98633749-98633771 CATGTTAAATGAGCATTTTGTGG - Intergenic
1029289831 7:99493872-99493894 CATTTTAAATGTGAGGAATGCGG - Exonic
1033821361 7:145138497-145138519 CATGCTAATAGTGGCGTTTGGGG + Intergenic
1035824702 8:2631840-2631862 CTTGTGGAGTGTGGGGTTTGTGG + Intergenic
1035835461 8:2746669-2746691 GATGTTAGCTGTGGGGTTTGTGG - Intergenic
1035975574 8:4307028-4307050 CATGTCCACTGTGGGGTTTATGG + Intronic
1036625882 8:10471171-10471193 CATGTGAAAGGTAGGGTTGGGGG - Intergenic
1037439040 8:18895252-18895274 CATGTTAAATGTGTGACATGGGG - Intronic
1038285886 8:26206234-26206256 CATGTTAAACATGGGATCTGGGG - Intergenic
1038340085 8:26678901-26678923 GAAGTTGAATGTGGAGTTTGGGG - Intergenic
1038959658 8:32505189-32505211 CATTTTAAAAGTGGGGTTGGGGG + Intronic
1039770716 8:40684330-40684352 CATGTTAAATGTGGGGTTTGAGG - Intronic
1039985525 8:42444578-42444600 CATGTTACATGTGAGGTTTTGGG + Intronic
1040398818 8:47026530-47026552 CATGTTAATTTTGGGGTATTTGG + Intergenic
1040541251 8:48358236-48358258 GATGTTAGCTGTGGGTTTTGTGG - Intergenic
1042789128 8:72583832-72583854 CATCTTAAAACTGGGGTTTATGG + Intronic
1043558918 8:81467816-81467838 CATGATAAATTTGGGTTTAGGGG + Intergenic
1043565929 8:81547609-81547631 CATTTTAATTGTTGGCTTTGTGG - Intergenic
1043643618 8:82488931-82488953 AATGTTGCATGTGGGGTCTGTGG + Intergenic
1044202869 8:89457189-89457211 CATCTTTAATGTGGGATTTATGG - Intergenic
1044739810 8:95314676-95314698 CAAGTGAAATGAGGGGCTTGAGG - Intergenic
1046041548 8:108911941-108911963 GATGTTAGATGTGGGGGGTGGGG - Intergenic
1046638752 8:116702350-116702372 TATGATATATGTGGGATTTGAGG - Intronic
1047568088 8:126068268-126068290 CATGTTGAAAGTGGGGCTAGTGG + Intergenic
1048144979 8:131832856-131832878 CATTTTAACTGTCGGGTTTGTGG - Intergenic
1048711588 8:137217893-137217915 CAAATAAAATTTGGGGTTTGTGG - Intergenic
1050753626 9:8972382-8972404 AATGTTAAATGTGACTTTTGGGG - Intronic
1052285926 9:26785811-26785833 TATTTTAGATGTGGTGTTTGAGG - Intergenic
1054823711 9:69549267-69549289 CCTGCTAGATGTGGGTTTTGGGG + Intronic
1055856027 9:80689966-80689988 AATGTTAGAGGTGGGGCTTGTGG + Intergenic
1056290190 9:85135391-85135413 CATGTGACATGTGGGGATTATGG - Intergenic
1056655386 9:88504462-88504484 CATGGTGCATGTGGTGTTTGTGG + Intergenic
1057710039 9:97431964-97431986 CATAATGAAAGTGGGGTTTGGGG + Intronic
1058927912 9:109686774-109686796 AATGTTAAATGAGGAGTTAGTGG - Intronic
1059428157 9:114233991-114234013 CATGGAAAATCTGGGATTTGAGG - Intronic
1060760594 9:126245107-126245129 CAGATTAAATGTGGGAATTGAGG + Intergenic
1061706282 9:132455819-132455841 ACTCTTAACTGTGGGGTTTGGGG + Intronic
1186314014 X:8349463-8349485 CCTGTGACATGTGGGGATTGTGG + Intergenic
1187148510 X:16659919-16659941 AATGGAAAATGTGGGGTGTGTGG - Intronic
1187172730 X:16868069-16868091 CATCTTAAATTTGGGTGTTGCGG - Intronic
1187512839 X:19937834-19937856 TATGTGAAATGTGTGTTTTGAGG + Intronic
1188059551 X:25584387-25584409 CATGGTAGATATGGGGTTTAAGG + Intergenic
1188392149 X:29633999-29634021 CATGATTTCTGTGGGGTTTGGGG - Intronic
1188904398 X:35774688-35774710 CATGCTAAATTTGGGGGTTAAGG - Intergenic
1189080660 X:37968532-37968554 CATGGTAAATTTGGGGGTTAAGG - Intronic
1190448317 X:50553200-50553222 AATGGTGTATGTGGGGTTTGAGG + Intergenic
1191068671 X:56377825-56377847 CATGGTAAATTTGGGGTTTAAGG - Intergenic
1191871690 X:65751652-65751674 CATGCTACATGTAGGGATTGGGG - Intergenic
1192803267 X:74487260-74487282 CATGTTAAATTTGAGGGTTAAGG - Intronic
1193445391 X:81594891-81594913 AATGTTAAATGTTGAGTTAGTGG + Intergenic
1193538614 X:82743197-82743219 CATGGTAAATTTGGGGGTTAAGG - Intergenic
1194041703 X:88949408-88949430 AATGTTAAAGGTGGGGCTTAGGG - Intergenic
1194178756 X:90687763-90687785 GATGTTGGAAGTGGGGTTTGGGG - Intergenic
1197473391 X:126890812-126890834 GATGGGAAATGTGGGGTTGGAGG - Intergenic
1197495281 X:127172245-127172267 GATGATAAATGTGGGGGTGGGGG + Intergenic
1198114082 X:133528042-133528064 TATGTAAAATGAGGGGGTTGGGG + Intergenic
1200525422 Y:4269934-4269956 AATGTTGGAAGTGGGGTTTGGGG - Intergenic
1201535308 Y:15041545-15041567 AATGTTAAATGAGGAGTTTATGG - Intergenic