ID: 1039770718

View in Genome Browser
Species Human (GRCh38)
Location 8:40684337-40684359
Sequence GGAACTCCATGTTAAATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 127}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039770718_1039770723 -7 Left 1039770718 8:40684337-40684359 CCCCACATTTAACATGGAGTTCC 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1039770723 8:40684353-40684375 GAGTTCCAAATGGACAACGTGGG No data
1039770718_1039770729 24 Left 1039770718 8:40684337-40684359 CCCCACATTTAACATGGAGTTCC 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1039770729 8:40684384-40684406 ACAGGAACTGGTTGAGCCACTGG No data
1039770718_1039770726 12 Left 1039770718 8:40684337-40684359 CCCCACATTTAACATGGAGTTCC 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1039770726 8:40684372-40684394 TGGGCTTCCCTGACAGGAACTGG No data
1039770718_1039770725 6 Left 1039770718 8:40684337-40684359 CCCCACATTTAACATGGAGTTCC 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1039770725 8:40684366-40684388 ACAACGTGGGCTTCCCTGACAGG No data
1039770718_1039770722 -8 Left 1039770718 8:40684337-40684359 CCCCACATTTAACATGGAGTTCC 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1039770722 8:40684352-40684374 GGAGTTCCAAATGGACAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039770718 Original CRISPR GGAACTCCATGTTAAATGTG GGG (reversed) Intronic
901322583 1:8348760-8348782 GGAACTCAATGTTCCTTGTGTGG - Intergenic
905622420 1:39460057-39460079 TGACCTCCATGTTAAATATTTGG - Intronic
906783264 1:48591198-48591220 GGAAAACCATGTTAAAAGTGAGG - Intronic
906939138 1:50240361-50240383 GGAACTCAATGTTAGAAGTGTGG + Intergenic
908890682 1:68844149-68844171 GGAACACCATGTGAAATATAGGG + Intergenic
918315846 1:183322155-183322177 GGAATTCGGTGTTTAATGTGAGG - Intronic
919367979 1:196689437-196689459 AGACCTCCATGTTTAATGTCTGG - Exonic
919374647 1:196779179-196779201 AGACCTCCATGTTTAATGTCTGG - Exonic
919380755 1:196857621-196857643 AGACCTCCATGTTTAATGTCTGG - Intronic
921080018 1:211731748-211731770 GGAAGTCAATGTTCAATGAGAGG + Intergenic
921840639 1:219824557-219824579 GGAACTCCCTGTTACATGGCAGG + Intronic
1063787433 10:9401702-9401724 GGCATTCCATGTTAGATATGTGG - Intergenic
1066357744 10:34701491-34701513 GGAACCCCAAGGTAACTGTGGGG + Intronic
1067957760 10:50811339-50811361 TGAACTCCATTTAAAATGTTAGG + Intronic
1072472755 10:95729217-95729239 GGAACTCCATTTAAAATGTTAGG - Intronic
1073879275 10:107960700-107960722 GGAACTCCTTATTACATTTGGGG - Intergenic
1074972158 10:118548076-118548098 GGGACTCCCAGTAAAATGTGTGG - Intergenic
1075971342 10:126656388-126656410 GTAACTCCATTTTACATGTGAGG + Intronic
1082767756 11:57182274-57182296 GGAGCTCCATGTAGCATGTGAGG - Exonic
1082999326 11:59277276-59277298 GGAAATGCATATTAAAGGTGTGG + Intergenic
1083536914 11:63478027-63478049 GGATTTCCATGTTAAATTTTTGG + Intronic
1088990035 11:114945504-114945526 TGATCCCCATGTTAAAGGTGAGG - Intergenic
1094105537 12:26807499-26807521 GGAACACAATGTCATATGTGGGG + Intronic
1097247286 12:57613568-57613590 GAAATTCCATCTAAAATGTGAGG - Intronic
1099097607 12:78394696-78394718 GTAACAACATGTTAAATGTTAGG + Intergenic
1100693032 12:97059407-97059429 GAATCTCCATGTCAATTGTGAGG + Intergenic
1102885087 12:116515865-116515887 GGAACTCCCTGCTGAATGTCTGG - Intergenic
1104324455 12:127783179-127783201 GCAACTAGATGTTAACTGTGGGG - Intergenic
1108096426 13:46906174-46906196 AAAACTCCATGTTAGATGTGAGG - Intergenic
1108638932 13:52363858-52363880 AGAATTTCATGTTAAAAGTGAGG + Intergenic
1108651011 13:52479698-52479720 AGAATTTCATGTTAAATGTGAGG - Intergenic
1109128819 13:58554269-58554291 TGAACTCCATGTGAAATTTTTGG - Intergenic
1112422111 13:99261787-99261809 AGAACTCCATGGTTATTGTGAGG + Intronic
1113511449 13:110858090-110858112 GGAAGTGTATGTTAAATGTCAGG + Intergenic
1114456276 14:22855924-22855946 TTAGCTCCATGTTAAAGGTGAGG - Intergenic
1116352770 14:43886362-43886384 GGCACTCCATTTTATGTGTGTGG - Intergenic
1117693415 14:58333825-58333847 GGAAATCCATGCTAAATTGGTGG + Intronic
1119173210 14:72550162-72550184 GGATCGCCATGTTTAATGAGAGG - Intronic
1125359375 15:38849586-38849608 GGAACTCCAGGTTGATTGAGAGG + Intergenic
1126595176 15:50377566-50377588 GGAACTGCATAATAAAGGTGGGG + Intergenic
1129043810 15:72714861-72714883 GAATCTCCATGTTGAATTTGAGG + Intronic
1130334331 15:82946091-82946113 GGAACTTAGAGTTAAATGTGTGG - Intronic
1131894462 15:97011266-97011288 GGAAGTCCAAGATAAAAGTGCGG + Intergenic
1132211468 15:100026404-100026426 GCAACTGCATCTTAAATGGGAGG + Intronic
1132908908 16:2298559-2298581 GGATCTTCATGCTGAATGTGGGG - Intronic
1133317576 16:4893963-4893985 GGAACTCCTTGCTGAATGAGTGG - Intronic
1133466707 16:6034418-6034440 GGAAGTCCATGATCAAGGTGTGG + Intronic
1133667311 16:7981531-7981553 GGAACTGGAAGTTAAATTTGAGG - Intergenic
1137388683 16:48063491-48063513 AAAACTCCATGCTAAATGAGGGG - Intergenic
1138608749 16:58106226-58106248 GGAATTCCTTCTTAAGTGTGTGG - Intergenic
1138618742 16:58195425-58195447 GGTAATCCCTGTTTAATGTGAGG - Intronic
1139205212 16:65022480-65022502 GGAGATCCTTGTTAAACGTGAGG - Intronic
1141616479 16:85212598-85212620 GGAAGTCCAAGGTCAATGTGTGG - Intergenic
1146778652 17:35646306-35646328 TGGCCTCCATGTAAAATGTGAGG + Intronic
1147691182 17:42315774-42315796 TCAACTCCATGTCAAAGGTGAGG + Exonic
1153418590 18:4878871-4878893 AGAACACCATGAAAAATGTGGGG + Intergenic
1153600821 18:6779967-6779989 GGAACTTCATGGGAAATATGAGG + Intronic
1162275446 19:9650437-9650459 GGAACTTCATATGAAATTTGGGG - Intronic
1166761755 19:45228469-45228491 GGAACTTCATATTAAAAGTCTGG + Intronic
1168426375 19:56242425-56242447 GGAACTGCTTGTGAGATGTGTGG + Intronic
925269029 2:2589063-2589085 GCAACTCCATCTTGAATGGGAGG + Intergenic
929809558 2:45178304-45178326 GAAACTCTATTTTAAATGTTTGG + Intergenic
930421252 2:51155750-51155772 GAAAATACATTTTAAATGTGTGG - Intergenic
932219665 2:69989881-69989903 GTAACTGCATGTTAAATCAGCGG + Intergenic
935916347 2:107955127-107955149 GGATCACCCTGTTAAATGTGTGG - Intergenic
937480160 2:122250072-122250094 GGAAGTCCAAGATCAATGTGTGG - Intergenic
938699419 2:133862922-133862944 GGCAGTCAATGTCAAATGTGGGG - Intergenic
939283721 2:140101013-140101035 TGAACTCTATATTAAATTTGTGG + Intergenic
939895065 2:147781809-147781831 GGAACTCCAGATTATATCTGAGG - Intergenic
944915942 2:204360303-204360325 AGAACGCCATGTGAAGTGTGGGG + Intergenic
947064795 2:226211390-226211412 GAGACTCCATCTGAAATGTGTGG - Intergenic
947608038 2:231502400-231502422 GGAAAGCCATGATAAATATGAGG - Intergenic
948328521 2:237146174-237146196 GGACCTCCTTGTTAAATTTCTGG - Intergenic
1170671160 20:18434933-18434955 GGAACTCCATGTTAAATCCTTGG - Intronic
1172123638 20:32612689-32612711 GGAGCTGCCTGTTAAATATGTGG - Intergenic
1173944747 20:46941635-46941657 GTATCTCCATGATACATGTGAGG - Intronic
1174935806 20:54866921-54866943 GGACCTCCATGGGAAATGTCTGG + Intergenic
1181760705 22:25057012-25057034 GGAACTTCATGTAGAACGTGGGG - Intronic
1183171903 22:36194547-36194569 TGAACTCCAGGTCAAAGGTGGGG - Intronic
1183176844 22:36230630-36230652 GCAACTCCAGGTCAAAGGTGGGG - Intronic
1183178898 22:36245323-36245345 TGAACTCCAGGTCAAAGGTGGGG + Intergenic
1183181388 22:36262459-36262481 GCAACTCCAGGTCAAAGGTGGGG + Intronic
1184944673 22:47794748-47794770 GAAACTTCATCTTAAATTTGAGG - Intergenic
954848589 3:53581204-53581226 GGATCCCCATGTTTGATGTGTGG + Intronic
955080769 3:55656008-55656030 GGGACTCCAGTTTAAATTTGTGG + Intronic
956813732 3:72888939-72888961 GGTACTCGAGGTTAAATGAGAGG - Intronic
956881322 3:73513634-73513656 GGACCTCCATGTTAAATTCTTGG - Intronic
957311406 3:78524126-78524148 GGATCTCCATGTTAAGTGTCTGG - Intergenic
957795895 3:85006563-85006585 GGAACTTCATGCTAAATGCCGGG + Intronic
959956128 3:112239658-112239680 GGAACTTCATGATCACTGTGGGG - Intronic
960742412 3:120849682-120849704 AGAAATCCTGGTTAAATGTGAGG - Intergenic
964514878 3:157497138-157497160 TTGACTCCATGTAAAATGTGAGG + Intronic
964800468 3:160551545-160551567 AGAACTGAATGTTAAATGTGAGG + Intronic
967597290 3:191341800-191341822 GTAACTCCCTGTTACTTGTGTGG + Intronic
968227793 3:196986180-196986202 GAAAGTCCATGTTCAATCTGGGG - Intergenic
971763641 4:30802102-30802124 GGATCTTCAACTTAAATGTGAGG + Intronic
973023165 4:45229788-45229810 GACACTCCATGCTAAATGTCTGG - Intergenic
977512659 4:97980516-97980538 GGGCCACCATGTTAAATGTTAGG + Intronic
978606772 4:110489186-110489208 GGAAGTGCTTGTTAAATGTCTGG + Intronic
979763047 4:124430736-124430758 TGAAATTCATGTTATATGTGTGG - Intergenic
979807377 4:124991233-124991255 AGTACTCCATGGCAAATGTGTGG - Intergenic
983939618 4:173525857-173525879 GGAACTCAATATTAACTGTGCGG - Intronic
987955213 5:24729845-24729867 GGATTTCCCTGCTAAATGTGAGG - Intergenic
990171511 5:53055405-53055427 GTAACTCCATATTAATTCTGAGG - Intronic
994743345 5:103648031-103648053 GATATTCCATGATAAATGTGAGG - Intergenic
995394128 5:111669584-111669606 GGAGCTCCTTGTCAAATGTGAGG + Intronic
996387813 5:122927153-122927175 TAAACTCCATGTTATAGGTGAGG + Intronic
996671638 5:126124063-126124085 GGAAATCAATGTTAAATATAAGG + Intergenic
997513787 5:134470893-134470915 GTAACTCCATGTTTAAGCTGTGG + Intergenic
998712042 5:144837100-144837122 GGAAATTCAAGCTAAATGTGAGG - Intergenic
999784275 5:154877436-154877458 GGAACTCAGTGTTGAGTGTGGGG + Intergenic
1001416762 5:171550511-171550533 GGAACTCCATATTAATCATGTGG + Intergenic
1003685727 6:8300078-8300100 GAAGCTCCATGTTTACTGTGGGG - Intergenic
1006184544 6:32173670-32173692 GGAACAGCATGTTCAAGGTGGGG - Intronic
1006745114 6:36336253-36336275 GGAACCCCCTGATAAATGAGAGG - Intronic
1007492968 6:42238604-42238626 TGAGCACCATGTTAAATGTATGG - Intronic
1010771817 6:79840602-79840624 GGGACTTCATGGGAAATGTGTGG - Intergenic
1011112759 6:83855714-83855736 GGGAGTCCATGGTAAATGTAGGG + Intronic
1011443203 6:87409040-87409062 TGAACTCTATTTTAGATGTGCGG + Intronic
1013029758 6:106321802-106321824 AGAACTCCCAGTTCAATGTGGGG - Intronic
1013143296 6:107362104-107362126 GGAATTCCCTGTTAAATATTTGG - Intronic
1013969263 6:115997361-115997383 GGAACTCCAAGTTCACTGTGAGG + Intronic
1017683284 6:156885743-156885765 GGAACTCCATTTTAAAGTTGTGG - Intronic
1017862664 6:158413479-158413501 GTGATTCCATGTTAAATTTGGGG + Intronic
1018843747 6:167539509-167539531 GGAACTTAATCATAAATGTGCGG - Intergenic
1021064291 7:16154467-16154489 TGAATTATATGTTAAATGTGAGG + Intronic
1026126539 7:67584531-67584553 GCAACTCCATCTTGAATGGGAGG + Intergenic
1030611576 7:111695400-111695422 GGAACTGCATATTAAATCTTCGG - Intergenic
1031787536 7:126052794-126052816 GGAACCACATGTTAAAAATGAGG - Intergenic
1032338364 7:131047110-131047132 GGATCTCCTTGTTAAATTTCTGG + Intergenic
1035719928 8:1784331-1784353 GGAAGTCCAAGATAAAGGTGTGG + Exonic
1038310970 8:26445941-26445963 GGGACTCCCTGATACATGTGAGG + Intronic
1039770718 8:40684337-40684359 GGAACTCCATGTTAAATGTGGGG - Intronic
1050395747 9:5194002-5194024 GAAAATCAATGTTAAATGTCTGG - Intergenic
1050748485 9:8906798-8906820 GGATCTCCCTGTTAAACGTCTGG - Intronic
1051474673 9:17492685-17492707 GTAACTCTATGCTTAATGTGTGG - Intronic
1052748679 9:32466735-32466757 GCACCTGCATGTTAAATATGTGG + Intronic
1058615323 9:106820686-106820708 GGAACTCATTGTAAAATGTATGG + Intergenic
1194190689 X:90833688-90833710 TGAACTCCATGTTTTATGTCTGG + Intergenic
1195727417 X:107932768-107932790 GGTACTCCATTATAAATGTTAGG - Intergenic
1200537346 Y:4416109-4416131 TGAACTCCATGTTTTATGTCTGG + Intergenic
1201597154 Y:15683035-15683057 GGAAGTCCACGATCAATGTGTGG - Intergenic