ID: 1039770719

View in Genome Browser
Species Human (GRCh38)
Location 8:40684338-40684360
Sequence TGGAACTCCATGTTAAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039770719_1039770723 -8 Left 1039770719 8:40684338-40684360 CCCACATTTAACATGGAGTTCCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1039770723 8:40684353-40684375 GAGTTCCAAATGGACAACGTGGG No data
1039770719_1039770725 5 Left 1039770719 8:40684338-40684360 CCCACATTTAACATGGAGTTCCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1039770725 8:40684366-40684388 ACAACGTGGGCTTCCCTGACAGG No data
1039770719_1039770729 23 Left 1039770719 8:40684338-40684360 CCCACATTTAACATGGAGTTCCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1039770729 8:40684384-40684406 ACAGGAACTGGTTGAGCCACTGG No data
1039770719_1039770722 -9 Left 1039770719 8:40684338-40684360 CCCACATTTAACATGGAGTTCCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1039770722 8:40684352-40684374 GGAGTTCCAAATGGACAACGTGG No data
1039770719_1039770726 11 Left 1039770719 8:40684338-40684360 CCCACATTTAACATGGAGTTCCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1039770726 8:40684372-40684394 TGGGCTTCCCTGACAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039770719 Original CRISPR TGGAACTCCATGTTAAATGT GGG (reversed) Intronic
908890681 1:68844148-68844170 GGGAACACCATGTGAAATATAGG + Intergenic
912412978 1:109490677-109490699 AGGAACTTCATTTTAAATCTTGG - Intronic
913028842 1:114876121-114876143 TGGAAATGCATTTTAAGTGTAGG + Exonic
915160931 1:153920287-153920309 TGGACCTCCAGGTTGAATTTTGG - Intronic
920585504 1:207155733-207155755 TGGACCTCCTTGTTAATTATTGG + Intergenic
1065647585 10:27852015-27852037 TGGAGCACCATGTTTAAAGTTGG + Intronic
1068424930 10:56847486-56847508 TGAAATTACATGTTAAATTTCGG + Intergenic
1069260684 10:66391948-66391970 TAGTACTGCATTTTAAATGTAGG - Intronic
1071703384 10:87967672-87967694 TGGCCCTCCATGTTACATATTGG - Exonic
1073879276 10:107960701-107960723 TGGAACTCCTTATTACATTTGGG - Intergenic
1078472812 11:11605247-11605269 TGGAACTCCAAGTTATCTGCTGG - Intronic
1078593286 11:12664394-12664416 TCAAACTCCATGTCAGATGTTGG + Intergenic
1078810891 11:14761987-14762009 TAGAACTGCATATTAAATTTAGG - Intronic
1079138559 11:17792272-17792294 TGGAACTCCTGCTTAACTGTAGG - Intronic
1081310038 11:41559601-41559623 TGGAAATCCATGTTATATAAAGG + Intergenic
1081333065 11:41827828-41827850 AGCAATTCCATGTTACATGTGGG - Intergenic
1081920194 11:46768180-46768202 TGAAACTACAGTTTAAATGTTGG - Intronic
1082213194 11:49531703-49531725 TGGAATTCCATGTGAATTTTAGG + Intergenic
1084632398 11:70362183-70362205 CGCAACTGCATGTTAAATGAAGG - Intronic
1085067047 11:73506091-73506113 AGGACCTCCATGTTAACTGCAGG + Intronic
1088976417 11:114820490-114820512 TGTAACTCCATTCTAAGTGTAGG + Intergenic
1090064822 11:123493625-123493647 TCGAACTCCATGTGGAACGTGGG + Intergenic
1094105536 12:26807498-26807520 TGGAACACAATGTCATATGTGGG + Intronic
1108122786 13:47207968-47207990 AGGGACTTCATTTTAAATGTAGG - Intergenic
1108247136 13:48529204-48529226 TGTAAATCCATTTTAAATCTCGG + Intronic
1108716130 13:53079771-53079793 TGGAGCACCATGAGAAATGTCGG + Intergenic
1108748190 13:53417320-53417342 AGGAAGTCTATGTTATATGTAGG - Intergenic
1110138319 13:72096759-72096781 TAAAACTCCATATTAAAAGTGGG + Intergenic
1111265660 13:85808817-85808839 TGTAACTCCATCTTAAATCAAGG + Intergenic
1111628683 13:90822144-90822166 TGGAATAACATGATAAATGTTGG - Intergenic
1111840172 13:93440252-93440274 TGGAACTCCCTGTCACAAGTTGG + Intronic
1112968659 13:105231725-105231747 TGCAAATCTATGTCAAATGTAGG - Intergenic
1116370360 14:44122350-44122372 TGGAACTCCATGGAAAAGGTAGG - Intergenic
1117513880 14:56481050-56481072 TGTAACTCCATGGTAATTGGAGG - Intergenic
1119542634 14:75450814-75450836 TGGAACTCCCAGTTTAATGGAGG + Intronic
1121136390 14:91502633-91502655 TAGAACTCCATGTTCATTGTAGG - Intronic
1124129261 15:26970645-26970667 TGGAAAGGCATGTTAAAGGTAGG - Intergenic
1124196014 15:27630262-27630284 TTTAACGCCATGTTACATGTTGG + Intergenic
1126512416 15:49494435-49494457 TGGAAGTCCATGTTACAAGACGG + Intronic
1133903831 16:10002549-10002571 TGGAACTCCATGAGAGAAGTTGG + Intronic
1137853461 16:51769434-51769456 TGGAATTGCATCTTAAAGGTAGG - Intergenic
1140775772 16:78247744-78247766 TGGAACTCCATATCCAAGGTAGG - Intronic
1141447272 16:84069175-84069197 TTGAACTCCATGCTGAAAGTAGG - Intronic
1141970196 16:87476619-87476641 TGGAATTCCATTTTATCTGTTGG - Intronic
1150292071 17:63987861-63987883 TAGAACTCCTTGTCAAGTGTTGG - Intergenic
1152003184 17:77659914-77659936 TGGAACTCCATGGAATATGGTGG + Intergenic
1155415268 18:25592018-25592040 TGGAACGCCATTGTAAATGTTGG + Intergenic
1157851657 18:51058896-51058918 TGAAACTACATGTTATCTGTAGG - Intronic
1158327783 18:56329134-56329156 TTGAACTTCATTTTAAAAGTAGG - Intergenic
1162275447 19:9650438-9650460 TGGAACTTCATATGAAATTTGGG - Intronic
1164813745 19:31178369-31178391 TAACAGTCCATGTTAAATGTTGG + Intergenic
1167514368 19:49914507-49914529 TGAAACTCAAGGGTAAATGTTGG - Intronic
1168224865 19:54987392-54987414 TGGAACCCCATGATGCATGTAGG - Intronic
925648581 2:6064259-6064281 TGGATCTCCCTGTTCAATGGGGG + Intergenic
927126480 2:20016453-20016475 TGGAACTCCAAGTATCATGTTGG + Intergenic
927690379 2:25204030-25204052 TGGATTGCCAGGTTAAATGTAGG - Intergenic
931286592 2:60837022-60837044 TGGAAGTGAATGTTATATGTAGG - Intergenic
931514857 2:63044320-63044342 TGAAACCCTATGTTAAAGGTTGG - Intronic
933303113 2:80565251-80565273 TGGAACACCATGTTTAACATTGG + Intronic
935508395 2:103937300-103937322 TGTAACAGCATGTTAAATCTGGG + Intergenic
941415086 2:165210386-165210408 TGAAACTCCATGGTAAATAATGG - Intergenic
944105421 2:196074511-196074533 TGGAAGTCCATTTTAAAAGAAGG + Intergenic
1168811422 20:707030-707052 TGTACCTCCATTTTACATGTAGG - Intergenic
1170685342 20:18564569-18564591 TTGAACTCCATCTTGAAGGTAGG + Intergenic
1170881584 20:20301261-20301283 TGTAACTCCATACTAAGTGTTGG - Intronic
1175035198 20:55993733-55993755 TTGAAATCCATGTTAAAGGCAGG + Intergenic
1181760706 22:25057013-25057035 TGGAACTTCATGTAGAACGTGGG - Intronic
1181916211 22:26282478-26282500 TGGAGATCCATGGTAAATGAGGG - Intronic
951673404 3:25209905-25209927 TTGAAATCCAAGTTAAATGTAGG - Intronic
954953694 3:54498600-54498622 TGAAACTCAATGTTAAAAGAAGG - Intronic
957795894 3:85006562-85006584 TGGAACTTCATGCTAAATGCCGG + Intronic
957875836 3:86145789-86145811 TGGTACTCTATTTTAAGTGTTGG + Intergenic
964225752 3:154399540-154399562 TGGAACTCTAGGTTCAAAGTAGG - Intronic
971872927 4:32267535-32267557 TGGCACTTCAAGTTTAATGTAGG - Intergenic
973616149 4:52680101-52680123 TGGAACTCCATTTATATTGTTGG + Intergenic
974532323 4:63124671-63124693 TGTAAGTTTATGTTAAATGTTGG - Intergenic
976824606 4:89247058-89247080 TATAAATCCATGTTTAATGTAGG + Exonic
981844171 4:149147702-149147724 TTGAACTCCATGATAAAATTAGG + Intergenic
982753872 4:159195430-159195452 AGGAAGTGCGTGTTAAATGTCGG - Intronic
990138257 5:52673621-52673643 TGGAACTCAAAGTGAAATATAGG - Intergenic
990168729 5:53023298-53023320 GGGAACATCATGTTAAACGTAGG - Intronic
991579029 5:68135072-68135094 TGGATCTCACTGTTAAATCTAGG - Intergenic
991721154 5:69494803-69494825 TAGAACTCCATTTTAAAAGTGGG + Intronic
992063624 5:73083471-73083493 TAGAACTCTATGTTCCATGTAGG + Intronic
995878348 5:116816406-116816428 GGGAACTGCTTGTTGAATGTGGG + Intergenic
995987323 5:118194101-118194123 TGGAACTCACTGTTCACTGTCGG - Intergenic
996183608 5:120450581-120450603 TGCCACTGCATGTTGAATGTAGG - Intergenic
996515498 5:124364813-124364835 TGGCACTCCAACTTAAGTGTTGG - Intergenic
998064218 5:139144108-139144130 TGAAACTCCATGTGAATTTTAGG - Intronic
1000740766 5:164967637-164967659 TGGAACTACTTGGAAAATGTTGG - Intergenic
1000769734 5:165337782-165337804 TGGAACCGCATGTAGAATGTTGG + Intergenic
1004009198 6:11665491-11665513 TGGAACTCAAAGTTAAATAATGG + Intergenic
1005413629 6:25577629-25577651 AGGAATTACATGTTAAAAGTGGG + Intronic
1008251133 6:49241371-49241393 TGGCACTTCATGTTTAATGAAGG - Intergenic
1008530484 6:52453014-52453036 TGGATCTCCATATGAAATGTAGG - Intronic
1010478873 6:76324520-76324542 TAGAACTACAGGTTAAATGGTGG - Intergenic
1010542593 6:77110083-77110105 TGCAACTCCATGTTGAATAGGGG - Intergenic
1011112758 6:83855713-83855735 TGGGAGTCCATGGTAAATGTAGG + Intronic
1012582719 6:100888896-100888918 TGATACCCCATGATAAATGTGGG + Intergenic
1015842501 6:137489568-137489590 TGGAACGCGAAGTTAAATGTTGG + Intergenic
1017862663 6:158413478-158413500 TGTGATTCCATGTTAAATTTGGG + Intronic
1023588712 7:41758689-41758711 TGAAACTCCAAGTCAAAGGTTGG - Intergenic
1023594674 7:41816364-41816386 TGGAAGGTCATGTTAAATGCTGG + Intergenic
1027161740 7:75807672-75807694 AGCAACTCCATCTTAAATATGGG + Intergenic
1028259608 7:88645743-88645765 GAGAACTCCATGTAAAATGAAGG + Intergenic
1032924335 7:136585784-136585806 TTGAACTTCATTATAAATGTTGG + Intergenic
1034178108 7:149116244-149116266 TGGAATTCCATGTTAAGGTTAGG - Intronic
1036053078 8:5221800-5221822 GGGAAGTCAAAGTTAAATGTAGG - Intergenic
1036212319 8:6852419-6852441 TGGACCTCCAGGAAAAATGTAGG - Intergenic
1037169678 8:15876270-15876292 TGTAACTGTATTTTAAATGTTGG - Intergenic
1039770719 8:40684338-40684360 TGGAACTCCATGTTAAATGTGGG - Intronic
1040741121 8:50577650-50577672 TGGAACACTGTGTTATATGTTGG + Intronic
1043070484 8:75630514-75630536 TGAAACTCCATGTTGGAGGTTGG - Intergenic
1046040357 8:108896316-108896338 TGAAACTCCACGTTAAAATTTGG + Intergenic
1047806537 8:128366854-128366876 AGGAACTCCATGTTATTTGGTGG - Intergenic
1056142082 9:83691834-83691856 TGGCACTTCATGCTAAAAGTTGG + Intronic
1202799565 9_KI270719v1_random:163169-163191 AGGAACTTCCTGTTAAGTGTGGG + Intergenic
1189972719 X:46434421-46434443 TGGGAATCCATGTAAGATGTAGG + Intergenic
1192271075 X:69580153-69580175 TGGCACTCCAACTTACATGTTGG + Intergenic
1196500963 X:116381865-116381887 TGAAACTTAATCTTAAATGTGGG + Intergenic
1198252819 X:134897730-134897752 TGGAATTCAATTTTAAGTGTAGG - Intronic
1199348386 X:146769265-146769287 TGAATCACCATGTTAAATTTTGG - Intergenic
1200706153 Y:6444303-6444325 TGCAACCCTATGTTAAAAGTGGG + Intergenic
1201027958 Y:9720405-9720427 TGCAACCCTATGTTAAAAGTGGG - Intergenic