ID: 1039770720

View in Genome Browser
Species Human (GRCh38)
Location 8:40684339-40684361
Sequence TTGGAACTCCATGTTAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039770720_1039770722 -10 Left 1039770720 8:40684339-40684361 CCACATTTAACATGGAGTTCCAA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1039770722 8:40684352-40684374 GGAGTTCCAAATGGACAACGTGG No data
1039770720_1039770723 -9 Left 1039770720 8:40684339-40684361 CCACATTTAACATGGAGTTCCAA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1039770723 8:40684353-40684375 GAGTTCCAAATGGACAACGTGGG No data
1039770720_1039770725 4 Left 1039770720 8:40684339-40684361 CCACATTTAACATGGAGTTCCAA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1039770725 8:40684366-40684388 ACAACGTGGGCTTCCCTGACAGG No data
1039770720_1039770729 22 Left 1039770720 8:40684339-40684361 CCACATTTAACATGGAGTTCCAA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1039770729 8:40684384-40684406 ACAGGAACTGGTTGAGCCACTGG No data
1039770720_1039770726 10 Left 1039770720 8:40684339-40684361 CCACATTTAACATGGAGTTCCAA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1039770726 8:40684372-40684394 TGGGCTTCCCTGACAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039770720 Original CRISPR TTGGAACTCCATGTTAAATG TGG (reversed) Intronic
900003848 1:31046-31068 TTGGAAGTCCAAGTTCAAGGTGG - Intergenic
900023570 1:201566-201588 TTGGAAGTCCAAGTTCAAGGTGG - Intergenic
902927066 1:19703016-19703038 TTGAACCTCCATGTTAGAGGAGG - Intronic
904892545 1:33789965-33789987 TTTTCACTCTATGTTAAATGAGG + Intronic
910661339 1:89676771-89676793 TTGAAACTCCTTTGTAAATGGGG - Intronic
910852188 1:91659449-91659471 TTAGAACTCTATTTTGAATGAGG - Intergenic
911458461 1:98157941-98157963 TTAGTACTCCATGTTAAAACAGG + Intergenic
912944721 1:114075453-114075475 TTGAGACTACATGTTAAATAAGG + Intergenic
918286872 1:183065202-183065224 TAGGAACACCATCTTATATGTGG + Intronic
922636044 1:227172471-227172493 TTTGAATTACATTTTAAATGTGG - Intronic
923327669 1:232895313-232895335 GTGGATCTATATGTTAAATGGGG - Intergenic
1064125955 10:12660282-12660304 TTTTAACTCCATGGCAAATGAGG - Intronic
1065358995 10:24871454-24871476 TTGGAACTCCAAGTTAAAACTGG + Intronic
1073387451 10:103138132-103138154 TTGAAACTCCATGACAAATATGG - Intronic
1073879277 10:107960702-107960724 TTGGAACTCCTTATTACATTTGG - Intergenic
1074306533 10:112284296-112284318 TTTTAATTCCATGTTAAACGTGG + Intronic
1078715833 11:13838300-13838322 TAGGAAGTCCATCTTAAATGAGG + Intergenic
1078879819 11:15437105-15437127 TTGTAACTTCATCTTGAATGAGG + Intergenic
1080954756 11:37080406-37080428 TTGGAACACCTAGTTAACTGTGG + Intergenic
1081252568 11:40853021-40853043 TGGGACCTCCATCTTACATGCGG - Intronic
1082720734 11:56672566-56672588 TTGAAACTCCGTGTTTAATTTGG - Intergenic
1086112152 11:83211367-83211389 TTGCAACTTCTTGTTAAATGGGG + Exonic
1086435702 11:86779214-86779236 TTGGTACTAATTGTTAAATGAGG + Intergenic
1087478517 11:98668795-98668817 TTGTAAATCCATGCTAACTGAGG + Intergenic
1087564126 11:99832254-99832276 TTGGAATGCATTGTTAAATGTGG - Intronic
1091377267 12:33100-33122 TTGGAAGTCCAAGTTCAAGGTGG - Intergenic
1093342166 12:17991405-17991427 GTGAAATTCAATGTTAAATGAGG - Intergenic
1093727466 12:22531573-22531595 ATGGAAGTCCATTTTAAAAGAGG + Intronic
1097966042 12:65582465-65582487 TTGGAAGTCCATATTTATTGAGG - Intergenic
1099037165 12:77602880-77602902 TTGGAATTCCCTGTTGCATGGGG - Intergenic
1099039623 12:77635594-77635616 TTGGAACTTCCTGATAAATTGGG + Intergenic
1104096142 12:125559827-125559849 TGACAGCTCCATGTTAAATGAGG + Intronic
1104379988 12:128298891-128298913 ATGGAACTTCAAGTTAAATGGGG - Intronic
1104432378 12:128726921-128726943 TTGCAACTCCATCTTGAATAGGG - Intergenic
1107667742 13:42709841-42709863 TGGGACCGCCATGATAAATGTGG + Intergenic
1110920569 13:81079448-81079470 TTGGAACCCCAGTTTAACTGGGG - Intergenic
1111251512 13:85607747-85607769 ATGGAAATTCATGTTAAATTAGG + Intergenic
1117291158 14:54334535-54334557 TTTGAACTTCATGGTAAATGTGG - Intergenic
1118485338 14:66209409-66209431 TTGTAAGTCCCTATTAAATGTGG - Intergenic
1122257569 14:100490234-100490256 TGGGAATACCATGGTAAATGAGG - Intronic
1131121495 15:89825819-89825841 TTGGAACACCATGTTTAAGCAGG + Intergenic
1132449655 15:101959890-101959912 TTGGAAGTCCAAGTTCAAGGTGG + Intergenic
1134514712 16:14877536-14877558 TAGGAGCTCCTTGTAAAATGGGG - Intronic
1134702388 16:16276189-16276211 TAGGAGCTCCTTGTAAAATGGGG - Intronic
1134833634 16:17343862-17343884 TTGTAACTCCAGGTCACATGAGG + Intronic
1134965155 16:18435926-18435948 TAGGAGCTCCTTGTAAAATGGGG + Intronic
1134969442 16:18518461-18518483 TAGGAGCTCCTTGTAAAATGGGG + Intronic
1135432481 16:22397302-22397324 TTGGAACACACTGTTGAATGGGG + Intronic
1135494166 16:22937134-22937156 CTGGAAGTCCATGTGAAATAAGG - Intergenic
1135508697 16:23062267-23062289 TTGGCACTCTGTGTTAACTGTGG - Exonic
1144179345 17:12737241-12737263 TTGAAACTCCATCTCAAAGGGGG + Intronic
1144231453 17:13208531-13208553 TAGGAACTCCTTCTTAAATAGGG - Intergenic
1147527190 17:41237164-41237186 TTAGAACTCCATGATGAATCAGG + Intronic
1147528313 17:41248828-41248850 TTAGAACTCCATGATGAATCAGG + Intronic
1147530318 17:41270351-41270373 TTGGAACTCCAAGACAAATCAGG + Intergenic
1153968601 18:10204171-10204193 TGGGAACTCCATGTAACCTGTGG + Intergenic
1155614394 18:27704334-27704356 TTGGAGCTCCATGCCAAATTAGG + Intergenic
1156125671 18:33902199-33902221 TTGGTCCTCTATGTTAAATGAGG + Intronic
1160635601 19:72655-72677 TTGGAAGTCCAAGTTCAAGGTGG - Intergenic
1162275448 19:9650439-9650461 TTGGAACTTCATATGAAATTTGG - Intronic
1163832832 19:19555199-19555221 TGGGACCTGCATGTTAAATGGGG - Intergenic
925648580 2:6064258-6064280 ATGGATCTCCCTGTTCAATGGGG + Intergenic
928962999 2:36948471-36948493 TTGGACTTCAATGTTAAATTTGG + Intronic
931390791 2:61842093-61842115 TTGTAACTCAATGTTATTTGTGG - Intronic
933976611 2:87517152-87517174 TGGGAACTCCATGTAACTTGTGG + Intergenic
936317208 2:111433652-111433674 TGGGAACTCCATGTAACTTGTGG - Intergenic
936565881 2:113582393-113582415 TTGGAAGTCCAAGTTCAAGGTGG + Intergenic
937882838 2:126881373-126881395 TGGGAAGTTCATGTTGAATGGGG + Intergenic
938599771 2:132825273-132825295 CTGGAAGTTCATATTAAATGTGG - Intronic
939374887 2:141351657-141351679 TTGGAGCTCCATGCTAAAAAGGG - Intronic
940250025 2:151664937-151664959 TTACAACTCCATGGTAAAAGAGG + Intronic
941630115 2:167875048-167875070 TTTGAACTCCAAGGTATATGGGG - Intergenic
943213603 2:185001522-185001544 GTTAAACTCCATGTTAAATGAGG - Intergenic
943777277 2:191779879-191779901 TGGGAAGTCCAGTTTAAATGAGG - Intergenic
943991226 2:194695322-194695344 TTCAAACTCAATATTAAATGTGG - Intergenic
945059260 2:205894145-205894167 TTTGAACTGAATCTTAAATGGGG - Intergenic
945717448 2:213377515-213377537 ATTTAACTTCATGTTAAATGTGG - Intronic
1169852268 20:10065199-10065221 CTAGAACTCCAAGTGAAATGAGG + Intergenic
1176907603 21:14522066-14522088 TTGTAATTCTATGTTAAATGTGG - Intronic
1177572658 21:22907341-22907363 TTGGAAAACCATGTTTAATCCGG - Intergenic
1179248290 21:39651797-39651819 CTGGAAATCATTGTTAAATGAGG + Intronic
1179380243 21:40892010-40892032 TTGGAATTTTATGTTAAAGGTGG + Intergenic
1181916212 22:26282479-26282501 CTGGAGATCCATGGTAAATGAGG - Intronic
951926935 3:27917698-27917720 TTGCAGTTCCATGTTAATTGGGG + Intergenic
952823338 3:37504082-37504104 TGGGAACTTCTTGTTAAATGGGG + Intronic
954423730 3:50432387-50432409 TTGGAACTGTCTGATAAATGCGG - Intronic
957121519 3:76100849-76100871 TAATAAATCCATGTTAAATGAGG - Intronic
958937826 3:100276463-100276485 TTGGAAATGCATATTAAATTTGG + Intronic
960218434 3:115072583-115072605 TTGGATATCCATGTTTAAAGAGG + Intronic
963850743 3:150208211-150208233 ATGGAACCCCATGTTGAATGAGG + Intergenic
964890954 3:161533724-161533746 TTGGGACTACATCTTACATGTGG - Intergenic
965719959 3:171650611-171650633 TTGGCACTTCCTGATAAATGTGG - Intronic
966562103 3:181333546-181333568 TTGTAACTTCAATTTAAATGTGG + Intergenic
972260136 4:37399527-37399549 TTGGGCCACCAGGTTAAATGAGG - Intronic
972277138 4:37568026-37568048 TTTGATATCCATGTTGAATGTGG - Intronic
974248402 4:59353321-59353343 TTGGAACACATTCTTAAATGTGG + Intergenic
976138381 4:81963132-81963154 AAGGAACTCCATGTCAATTGGGG - Intronic
976249239 4:83033756-83033778 TTGAAACTTCATCTTTAATGTGG - Intergenic
980989289 4:139725109-139725131 TTGGCACTCCTTTATAAATGTGG - Intronic
986394878 5:7319045-7319067 TTGCAACTCCATGTCTAATGAGG - Intergenic
987373290 5:17212646-17212668 TTGCAACTCCATCTTGAATAGGG - Intronic
989827660 5:45877860-45877882 TGGGAACACCATCATAAATGAGG - Intergenic
991721153 5:69494802-69494824 GTAGAACTCCATTTTAAAAGTGG + Intronic
996330921 5:122327892-122327914 TATGATCTCCATGTGAAATGGGG + Intronic
996926308 5:128830514-128830536 TTTGACTACCATGTTAAATGTGG - Intronic
999455920 5:151716005-151716027 TTTAAACCCCATGTTGAATGTGG + Intergenic
1000129200 5:158278826-158278848 TTTGAACTTCATGTTGTATGAGG + Intergenic
1004703675 6:18102806-18102828 TGGGAACTGCATGTTAAAAGAGG - Intergenic
1005413628 6:25577628-25577650 TAGGAATTACATGTTAAAAGTGG + Intronic
1007893416 6:45319284-45319306 TTGGAACTTTATCATAAATGAGG + Intronic
1009853844 6:69233482-69233504 AGGGAACTGCATTTTAAATGGGG + Intronic
1010542594 6:77110084-77110106 GTGCAACTCCATGTTGAATAGGG - Intergenic
1012001220 6:93657640-93657662 TTGAAACTCCATGTTAAAATTGG - Intergenic
1012223829 6:96683196-96683218 TTGGGAATGCTTGTTAAATGTGG - Intergenic
1015090058 6:129345139-129345161 TTGGAACTCCTTCAGAAATGAGG - Intronic
1017862662 6:158413477-158413499 TTGTGATTCCATGTTAAATTTGG + Intronic
1017864901 6:158434855-158434877 TTGAGACTCCAGTTTAAATGTGG + Intronic
1019319120 7:407352-407374 TGGGGAGTCCATGTTTAATGGGG + Intergenic
1020876744 7:13704929-13704951 TTGTAACTTCAAGCTAAATGAGG - Intergenic
1021191905 7:17630524-17630546 CTGCAACTGCATGTCAAATGTGG + Intergenic
1022877297 7:34547734-34547756 TTGGAAATACATGTTAAAATGGG + Intergenic
1027622589 7:80508814-80508836 TTTGCAGTACATGTTAAATGTGG + Intronic
1030838513 7:114319004-114319026 TTGGAACCCCAATTTAACTGGGG - Intronic
1033323291 7:140359366-140359388 ATGGAAATACATGTAAAATGAGG - Intronic
1037391706 8:18399729-18399751 TTGGAAATCCAGATTAAATAAGG - Intronic
1037463842 8:19139632-19139654 TTGGTACTTCATGTTAGTTGAGG + Intergenic
1038732766 8:30141958-30141980 TTGGACCACAATGTTAACTGGGG - Intronic
1039770720 8:40684339-40684361 TTGGAACTCCATGTTAAATGTGG - Intronic
1042159068 8:65873847-65873869 TGGCAACTCCATCTTAAATAGGG + Intergenic
1044411136 8:91884574-91884596 TTGGATCTTAATGATAAATGCGG + Intergenic
1046325603 8:112641042-112641064 TTAGAACCCCATTTTAAATATGG - Intronic
1049886543 9:30828-30850 TTGGAAGTCCAAGTTCAAGGTGG - Intergenic
1050091916 9:2024011-2024033 TTGGAGGTCCAGGTTAAAGGTGG - Intronic
1051191207 9:14515392-14515414 TAGGAGCTCCATGTTAAAGTGGG + Intergenic
1051669259 9:19493880-19493902 CTGCATCTCCATGTTGAATGGGG - Intergenic
1057589043 9:96355981-96356003 TTGGATCCCCATGTTGAAGGTGG + Intronic
1058957148 9:109959721-109959743 TAGAAACTCCAAGTTGAATGGGG + Intronic
1059161863 9:112042063-112042085 TTGGGATTCTTTGTTAAATGGGG - Intronic
1061562641 9:131415975-131415997 CTGGAACTCCTAGTTAAATCTGG + Intronic
1202799564 9_KI270719v1_random:163168-163190 TAGGAACTTCCTGTTAAGTGTGG + Intergenic
1186259981 X:7767077-7767099 GTGGATCTCCATTTTATATGGGG - Intergenic
1187497250 X:19805847-19805869 ATGGGACTGCATGTTAGATGAGG - Intronic
1188348429 X:29097353-29097375 TTGGAACTCCAAGAAAAAAGAGG + Intronic
1194663182 X:96648533-96648555 TTTGACCTCCATGTTAGAAGGGG - Intergenic
1198024690 X:132693604-132693626 AGGGAACCCCATGTTCAATGTGG + Intronic
1198667044 X:139036182-139036204 TTGGAACTCCATATCCTATGAGG - Intronic