ID: 1039770724

View in Genome Browser
Species Human (GRCh38)
Location 8:40684358-40684380
Sequence GGAAGCCCACGTTGTCCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039770724_1039770729 3 Left 1039770724 8:40684358-40684380 CCAAATGGACAACGTGGGCTTCC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1039770729 8:40684384-40684406 ACAGGAACTGGTTGAGCCACTGG No data
1039770724_1039770731 25 Left 1039770724 8:40684358-40684380 CCAAATGGACAACGTGGGCTTCC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1039770731 8:40684406-40684428 GCACTCCCAATGCCCACTGCAGG No data
1039770724_1039770726 -9 Left 1039770724 8:40684358-40684380 CCAAATGGACAACGTGGGCTTCC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1039770726 8:40684372-40684394 TGGGCTTCCCTGACAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039770724 Original CRISPR GGAAGCCCACGTTGTCCATT TGG (reversed) Intronic
900396723 1:2456143-2456165 GGAGGCCCAGCTTGTCCCTTGGG + Intronic
905576707 1:39050284-39050306 GGAAGTCCAGGTTTTCCACTTGG - Intergenic
905638468 1:39572129-39572151 GAAAGCCCACGTTTTTCTTTTGG - Intronic
909609176 1:77535051-77535073 GGAAGCCCAAGTTAGCCATGTGG - Intronic
1063252034 10:4284217-4284239 GGAAGCCCAGATTTTCCAGTAGG + Intergenic
1066650854 10:37653864-37653886 GGAAGCCCAAGTTATCCATATGG + Intergenic
1066990497 10:42508815-42508837 ATAGTCCCACGTTGTCCATTGGG + Intergenic
1067034410 10:42902354-42902376 GGAAGCCCAAGTTATCCATATGG + Intergenic
1067549350 10:47222709-47222731 GAAAGCCCACATTTTCCACTTGG - Intergenic
1075730966 10:124636645-124636667 AGAGGCCCACGTTGGCCACTGGG + Intronic
1081438222 11:43051820-43051842 GGAAGGCCACGTTCTCCACAAGG - Intergenic
1082237524 11:49837197-49837219 AGAAGCCCATGTTGCCGATTAGG - Intergenic
1082659028 11:55887528-55887550 AGAAGCCCATGTTGCCGATTAGG + Intronic
1084560914 11:69905009-69905031 GGGAGGCCACGCTGTCCACTGGG - Intergenic
1091126700 11:133106277-133106299 GTATGCTCACGCTGTCCATTTGG + Intronic
1094339629 12:29396451-29396473 GGAATCCCAAGTTCTTCATTTGG - Intergenic
1101811432 12:108111481-108111503 GGAAGCCCACGTTGCCCTGGAGG - Intergenic
1104230024 12:126875657-126875679 GGAAGACCGCATTATCCATTAGG + Intergenic
1105946582 13:25195713-25195735 GGAAGCCCAGGCTGCCCATGAGG + Intergenic
1106002570 13:25738051-25738073 TGAAGACCACGTCGTACATTAGG + Intronic
1109117729 13:58409909-58409931 GGAAGTCCAGGTTCTCCATTTGG - Intergenic
1129782323 15:78280831-78280853 GGATGCCCACTTTGTGCCTTGGG - Exonic
1132615928 16:841064-841086 GGAAGCTCACGTTTCCCCTTGGG + Intergenic
1138508668 16:57494463-57494485 AGAAGTCCACGTTCTCCACTTGG + Intergenic
1139438932 16:66954237-66954259 GGACACCCACTTTGCCCATTTGG + Intergenic
1139482614 16:67238937-67238959 GGAAGCCCACGCTGATCCTTCGG - Exonic
1142433520 16:90043249-90043271 TGAAGCCCACGTTGTCCAGAGGG - Exonic
1144443001 17:15300909-15300931 TGCAGCCCACGTTTTCCTTTTGG - Intergenic
1145225229 17:21123027-21123049 GGAAGTCCAGGTTTTCCACTTGG + Intergenic
1150256855 17:63753661-63753683 AGAAGCCCACAATGTCCATAGGG - Intronic
1153225353 18:2895653-2895675 GGAAGCCCAGGTTGGCCACATGG - Intronic
1167278239 19:48551886-48551908 TGGAGCCCACGTTGCTCATTTGG - Intergenic
1168443525 19:56392129-56392151 GGAAGCCCTCCTTGTCCTTGAGG - Intronic
925888631 2:8414918-8414940 GGAAGCCCCCTTTCTCCTTTAGG - Intergenic
929897467 2:45974573-45974595 GGAAGCACACGCTGCGCATTTGG + Intronic
933936850 2:87213078-87213100 GGAAGTCCAGGTTACCCATTTGG + Intergenic
935574582 2:104695629-104695651 GGAAGCCCAAGCTAGCCATTTGG - Intergenic
936356293 2:111752747-111752769 GGAAGTCCAGGTTACCCATTTGG - Intergenic
937909699 2:127069433-127069455 GGAAGCCTGGGTTGACCATTGGG - Intronic
938922164 2:136005007-136005029 TGAAGCCCAAGCTGTCCACTTGG + Intergenic
940047971 2:149429836-149429858 GGAAGCCCAAGTAGTCCACAAGG - Intronic
948884091 2:240874398-240874420 TGTGGCCCACGTTGTCCCTTGGG - Intronic
1172047941 20:32094034-32094056 GCAGCCCCACGTTGCCCATTTGG + Intronic
1172884464 20:38222061-38222083 TGAGGTCCACATTGTCCATTTGG - Intronic
1173191273 20:40877739-40877761 GAAAGTCCACGTTTTTCATTTGG - Intergenic
1181776134 22:25161328-25161350 GGATGCCCACGTAGACCACTGGG + Intronic
1182858152 22:33536042-33536064 GCAAGCCCACTTTGTCCTCTGGG + Intronic
1184060262 22:42077341-42077363 GGAAGCCCATGTGGTCCGCTGGG - Exonic
1184987001 22:48142538-48142560 GGAAGCCCACCTTGCCCATGAGG + Intergenic
1185051252 22:48555427-48555449 GGGAGCCCACGTCCTCCATCAGG - Intronic
949342429 3:3044498-3044520 GGAAGCCCAGGTTATCCGTGGGG - Intronic
957434841 3:80161404-80161426 GGAAGCCCAAGTTAGCCATGCGG - Intergenic
958892350 3:99795423-99795445 GGAATCCCAGGTGGTCCAATGGG - Exonic
960196299 3:114772522-114772544 GGAAAACCAAGTTGACCATTAGG - Intronic
961445302 3:126977845-126977867 GGAGGCCCACTTTGGCCACTGGG - Intergenic
961485658 3:127213804-127213826 GGAAGTCCATGCTGTCCACTTGG - Intergenic
965460839 3:168960964-168960986 GGAAGTCCACAGTGTACATTAGG + Intergenic
966124727 3:176562608-176562630 GGAAGCCCAAGTTACCCAATGGG - Intergenic
973880718 4:55268890-55268912 GGAATCCCTGGTTGTCCTTTGGG - Intergenic
982306973 4:153943090-153943112 GGAAGCCCATGTTGTTCTTCAGG + Intergenic
988448541 5:31315562-31315584 GAAAGCCCAGGCTGTTCATTTGG - Intronic
992198987 5:74365925-74365947 GGAAGCCCAACTAGTCCATATGG - Intergenic
992546654 5:77820285-77820307 GGAAGAGCACGTTGTTCTTTGGG - Intronic
1000829689 5:166087297-166087319 GGAAGCCCCAGCTGTCCATATGG - Intergenic
1001531949 5:172469603-172469625 GGAAGTCCAGGTTTTCCACTTGG + Intergenic
1002475403 5:179462235-179462257 GGAAGCACACGTGGTGTATTTGG - Intergenic
1007916484 6:45566216-45566238 GGAAGCCCAAGCTAGCCATTTGG - Intronic
1018416033 6:163602946-163602968 GCAAGCCCACTTTCTACATTAGG - Intergenic
1027893459 7:84008661-84008683 GCAAGCACATGTTGTTCATTTGG - Intronic
1032689253 7:134266068-134266090 AGAAGCCCAAGTTCTCCACTTGG - Intergenic
1036613179 8:10367474-10367496 GGAAGCCCTCCTTATCCATGAGG - Intronic
1039770724 8:40684358-40684380 GGAAGCCCACGTTGTCCATTTGG - Intronic
1040318985 8:46280649-46280671 GTAGTCCCAGGTTGTCCATTGGG - Intergenic
1041537625 8:58944577-58944599 GGAAGCAGACCTTGTCCATTGGG - Intronic
1045011575 8:97963409-97963431 GGAAGCCCACCTTGGCCCATGGG + Intronic
1047200579 8:122761766-122761788 GGAAGTCCAGGTTCTCCACTTGG - Intergenic
1048378770 8:133845783-133845805 GGAAGCGCATGTTCTCCATGTGG + Intergenic
1052287059 9:26798069-26798091 AGAAGCACACGTTTTCAATTTGG + Intergenic
1052704060 9:31972553-31972575 GGAAGCCCATGTTTTCCAAAAGG - Intergenic
1056885940 9:90443866-90443888 GGAAGCCTACGTTGGCCATAAGG - Intergenic
1057181178 9:93031396-93031418 GGAAGTCCAGGTTGGCCATGAGG - Intronic
1057794546 9:98146067-98146089 TGAAAGCCACGGTGTCCATTAGG + Intronic
1058328395 9:103727131-103727153 AGAAGCCCATGTTTTCCATTAGG + Intergenic
1186872171 X:13783903-13783925 GAAAGAACATGTTGTCCATTGGG - Intronic
1189592111 X:42524512-42524534 GCAAGCCCAGGTTATCCATGTGG + Intergenic
1190384216 X:49868650-49868672 GGAAGTCCAAGTTTCCCATTTGG + Intergenic