ID: 1039770726

View in Genome Browser
Species Human (GRCh38)
Location 8:40684372-40684394
Sequence TGGGCTTCCCTGACAGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039770718_1039770726 12 Left 1039770718 8:40684337-40684359 CCCCACATTTAACATGGAGTTCC 0: 1
1: 0
2: 0
3: 14
4: 127
Right 1039770726 8:40684372-40684394 TGGGCTTCCCTGACAGGAACTGG No data
1039770719_1039770726 11 Left 1039770719 8:40684338-40684360 CCCACATTTAACATGGAGTTCCA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 1039770726 8:40684372-40684394 TGGGCTTCCCTGACAGGAACTGG No data
1039770724_1039770726 -9 Left 1039770724 8:40684358-40684380 CCAAATGGACAACGTGGGCTTCC 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1039770726 8:40684372-40684394 TGGGCTTCCCTGACAGGAACTGG No data
1039770716_1039770726 19 Left 1039770716 8:40684330-40684352 CCTCAAACCCCACATTTAACATG 0: 1
1: 0
2: 0
3: 24
4: 285
Right 1039770726 8:40684372-40684394 TGGGCTTCCCTGACAGGAACTGG No data
1039770720_1039770726 10 Left 1039770720 8:40684339-40684361 CCACATTTAACATGGAGTTCCAA 0: 1
1: 0
2: 0
3: 14
4: 131
Right 1039770726 8:40684372-40684394 TGGGCTTCCCTGACAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039770726 Original CRISPR TGGGCTTCCCTGACAGGAAC TGG Intronic
No off target data available for this crispr