ID: 1039774865

View in Genome Browser
Species Human (GRCh38)
Location 8:40725350-40725372
Sequence TTTCCTGAGGGGCCTTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039774861_1039774865 7 Left 1039774861 8:40725320-40725342 CCTAATTAGAAACAAAGCTAATG 0: 1
1: 0
2: 3
3: 54
4: 450
Right 1039774865 8:40725350-40725372 TTTCCTGAGGGGCCTTCCTCAGG No data
1039774859_1039774865 25 Left 1039774859 8:40725302-40725324 CCCAAAAGGCAGAAAGGACCTAA 0: 1
1: 0
2: 3
3: 27
4: 317
Right 1039774865 8:40725350-40725372 TTTCCTGAGGGGCCTTCCTCAGG No data
1039774858_1039774865 26 Left 1039774858 8:40725301-40725323 CCCCAAAAGGCAGAAAGGACCTA 0: 1
1: 0
2: 2
3: 17
4: 291
Right 1039774865 8:40725350-40725372 TTTCCTGAGGGGCCTTCCTCAGG No data
1039774860_1039774865 24 Left 1039774860 8:40725303-40725325 CCAAAAGGCAGAAAGGACCTAAT 0: 1
1: 0
2: 4
3: 22
4: 319
Right 1039774865 8:40725350-40725372 TTTCCTGAGGGGCCTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039774865 Original CRISPR TTTCCTGAGGGGCCTTCCTC AGG Intronic
No off target data available for this crispr