ID: 1039784075

View in Genome Browser
Species Human (GRCh38)
Location 8:40817056-40817078
Sequence TAAGATACCCACCATTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039784073_1039784075 6 Left 1039784073 8:40817027-40817049 CCTTTCCACTTGCTTTTTTAAGA 0: 1
1: 0
2: 1
3: 47
4: 479
Right 1039784075 8:40817056-40817078 TAAGATACCCACCATTAAATTGG No data
1039784074_1039784075 1 Left 1039784074 8:40817032-40817054 CCACTTGCTTTTTTAAGATAATC 0: 1
1: 0
2: 1
3: 29
4: 360
Right 1039784075 8:40817056-40817078 TAAGATACCCACCATTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039784075 Original CRISPR TAAGATACCCACCATTAAAT TGG Intronic
No off target data available for this crispr