ID: 1039790068

View in Genome Browser
Species Human (GRCh38)
Location 8:40868551-40868573
Sequence GGCTGCCACTGAGCCCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039790068_1039790069 -4 Left 1039790068 8:40868551-40868573 CCAAGGAGGGCTCAGTGGCAGCC 0: 1
1: 0
2: 1
3: 28
4: 280
Right 1039790069 8:40868570-40868592 AGCCAATACAAGAAAACAATAGG No data
1039790068_1039790074 27 Left 1039790068 8:40868551-40868573 CCAAGGAGGGCTCAGTGGCAGCC 0: 1
1: 0
2: 1
3: 28
4: 280
Right 1039790074 8:40868601-40868623 TGAGTGGGTTGGAATTATTAAGG No data
1039790068_1039790073 16 Left 1039790068 8:40868551-40868573 CCAAGGAGGGCTCAGTGGCAGCC 0: 1
1: 0
2: 1
3: 28
4: 280
Right 1039790073 8:40868590-40868612 AGGAAAGAAAATGAGTGGGTTGG No data
1039790068_1039790072 12 Left 1039790068 8:40868551-40868573 CCAAGGAGGGCTCAGTGGCAGCC 0: 1
1: 0
2: 1
3: 28
4: 280
Right 1039790072 8:40868586-40868608 CAATAGGAAAGAAAATGAGTGGG No data
1039790068_1039790071 11 Left 1039790068 8:40868551-40868573 CCAAGGAGGGCTCAGTGGCAGCC 0: 1
1: 0
2: 1
3: 28
4: 280
Right 1039790071 8:40868585-40868607 ACAATAGGAAAGAAAATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039790068 Original CRISPR GGCTGCCACTGAGCCCTCCT TGG (reversed) Intronic
900507186 1:3035529-3035551 GGCTGTGACTGAGCTGTCCTGGG + Intergenic
901195821 1:7439248-7439270 TGCTGCCACTGACCCCTCCTAGG + Intronic
901499327 1:9641800-9641822 GGCCACCTCTCAGCCCTCCTTGG + Intergenic
902215245 1:14930681-14930703 GGCTGCCATGCTGCCCTCCTGGG + Intronic
902777131 1:18682292-18682314 GGCTGCCCCAGAGGCCTCCTGGG - Intronic
902922062 1:19672021-19672043 GGGTGGCACTGAGCCATCCTTGG + Intronic
903858757 1:26352845-26352867 GGCTGGCTCTGAGACCTGCTTGG - Intronic
903929848 1:26855905-26855927 GGCTGCGGCTGAGCCCCCATGGG + Exonic
904033239 1:27546111-27546133 TGCTGCCACTGAAGCTTCCTGGG - Intronic
904404797 1:30279353-30279375 GGTTCCCACTGAACCCTTCTGGG - Intergenic
904462633 1:30689302-30689324 GGCTGTCACTGATCTCTACTCGG - Intergenic
905247941 1:36627606-36627628 GGCTGTGACTCAGGCCTCCTGGG + Intergenic
905863091 1:41363134-41363156 GGCTGGCACTGAGGCCTCCCTGG - Intronic
906774302 1:48514830-48514852 GGCTGCAACTGAGGGGTCCTCGG + Intergenic
910426661 1:87125695-87125717 GTCTGCCACTGGGCCTTCCAGGG + Intronic
912320135 1:108705392-108705414 GGGTGCCACTGAGACTTACTGGG - Intergenic
915111230 1:153565748-153565770 GGCAGCCCCTGAGCCCACCCAGG + Exonic
915213077 1:154324516-154324538 GCCAGCCACTGACCCCGCCTGGG + Exonic
915268150 1:154733299-154733321 GGCTGCAACTGTGCCCACCCAGG + Intronic
915587946 1:156854455-156854477 GGCTGCAGGTGAGCCCTCCGGGG - Intronic
915703400 1:157819854-157819876 GCCTGACTCTGAGCCCTCCGTGG + Intronic
915909054 1:159900895-159900917 GGCTGGCACTGAGCTCACTTTGG + Intergenic
917376880 1:174358356-174358378 TGCTACAACTGAGCCCTCATTGG + Intronic
919454781 1:197808201-197808223 GGCCGCCACTGGGCTCTCTTTGG + Intergenic
919900154 1:202038206-202038228 AGGTGCCACTGAGCTCTCCTGGG - Intergenic
920709849 1:208285034-208285056 GGCTGCCCGTGAGCGCCCCTTGG - Intergenic
920765855 1:208833082-208833104 GGCTGACTGTGTGCCCTCCTAGG - Intergenic
921132008 1:212227895-212227917 GAGTGACACTGTGCCCTCCTGGG + Intergenic
921993194 1:221389721-221389743 AGCTGCCTCTGTGCCCTGCTGGG + Intergenic
922475931 1:225907052-225907074 GGCAGCCACAGAGCCAGCCTTGG - Intronic
922674462 1:227542247-227542269 GGCGGCTGCGGAGCCCTCCTGGG - Intergenic
1063346584 10:5317828-5317850 GCCTGCTGCTGAGTCCTCCTTGG + Intergenic
1063351666 10:5362449-5362471 GGCTCCCACTGGTCCATCCTGGG - Intergenic
1063795783 10:9512720-9512742 GGCTTCCACTCAAGCCTCCTCGG + Intergenic
1065115130 10:22477094-22477116 TCCTGCCACTCAGCCCCCCTAGG + Intergenic
1065848469 10:29766069-29766091 GGCTGCCACTGAGCTGCTCTGGG - Intergenic
1070003643 10:72401082-72401104 GTGTGCCACTGAGCCCAGCTTGG + Intronic
1071429745 10:85597539-85597561 GCCAGCAACTGAGCTCTCCTTGG + Intergenic
1071569863 10:86690971-86690993 GGCTTCACCTGAGCCCTCCCAGG + Intronic
1073030292 10:100520161-100520183 GGATTCCACTGAGGGCTCCTGGG - Intronic
1075343887 10:121668474-121668496 GGCTCCCACTGAGCCATCAAAGG + Intergenic
1076197377 10:128529021-128529043 GGCTGCCGGTGAGCCCTGCCTGG + Intergenic
1080700243 11:34638476-34638498 GGCTGTCCCTTAGCCTTCCTGGG - Intronic
1081937560 11:46916024-46916046 GCCTGATACTGAGCCATCCTTGG - Intronic
1083692550 11:64419217-64419239 GGCTCTCTCTGTGCCCTCCTCGG + Intergenic
1084044872 11:66562723-66562745 GGCTCCCAGTGTCCCCTCCTGGG - Intronic
1084117555 11:67050810-67050832 GGCTTCCAGGGAGCCCTGCTCGG + Exonic
1084359768 11:68661750-68661772 GGCTGCCACTGTGCCACCCGGGG - Intergenic
1085219918 11:74865142-74865164 GGCTGACACTGGGCCCCGCTGGG - Intronic
1085312174 11:75523320-75523342 GGCTGCCGCTTAGCCCGTCTGGG + Intronic
1088114674 11:106301140-106301162 AGCTGCCACTGAGCCAACCCTGG + Intergenic
1088713179 11:112526368-112526390 GGCTCCCACAGAGCCTTGCTTGG + Intergenic
1089074768 11:115729115-115729137 GCCTCCCACTGAGCCCTCAAGGG - Intergenic
1089332349 11:117698832-117698854 GGCTGCCAGTGAACTCTCCTGGG - Intronic
1091231852 11:133993285-133993307 TGTTGCCACTGTGCCTTCCTGGG + Intergenic
1091587172 12:1822911-1822933 GGCTCCCTCTCAGCCTTCCTGGG + Intronic
1092526127 12:9311328-9311350 CAGTGCCACTGAGTCCTCCTGGG + Intergenic
1092541152 12:9420455-9420477 CAGTGCCACTGAGTCCTCCTGGG - Intergenic
1094511891 12:31102020-31102042 CAGTGCCACTGAGTCCTCCTGGG + Intronic
1097221786 12:57455440-57455462 TGCTGTCACTGTGCCCTCATTGG + Exonic
1097281165 12:57846199-57846221 GGCTGGCACTCAGACCTCCGTGG - Intronic
1097696029 12:62775726-62775748 AGCTGCCACTGAGCATGCCTGGG + Intronic
1098893621 12:76032814-76032836 GGCTGCTACTGTGCCCACGTTGG + Exonic
1100861443 12:98811253-98811275 AACTCCCACTCAGCCCTCCTAGG + Intronic
1101326087 12:103717097-103717119 TGCTCCCACTGTGCCCTCCCAGG - Intronic
1101594030 12:106148016-106148038 GCCTGACACTGAGCCACCCTGGG - Intergenic
1102651253 12:114444117-114444139 GGCGGCCACAGAGGCGTCCTAGG + Intergenic
1103915195 12:124372434-124372456 GGCCCCCACTGAGCCCACCCCGG - Exonic
1105352618 13:19629632-19629654 GGCTGCAACTGAGGGGTCCTCGG - Intergenic
1106410780 13:29510174-29510196 AGTTGCCATGGAGCCCTCCTGGG - Exonic
1106881116 13:34131519-34131541 GCCTGCCTCTCAGTCCTCCTAGG + Intergenic
1109054174 13:57526215-57526237 GTCAGCCACTGAGCCCAGCTGGG - Intergenic
1112395626 13:99028189-99028211 GACTGCCACTGAGTCATTCTAGG + Intronic
1112638535 13:101245168-101245190 GGGTCCCAATGAGCCCTTCTTGG - Intronic
1113537763 13:111081857-111081879 GGCGGCCACCCAGTCCTCCTAGG + Intergenic
1114673690 14:24428090-24428112 GGCCGCCCCTCAGCCCTCCCGGG - Intronic
1117083035 14:52171039-52171061 GGCTGCAACTGAGGGGTCCTTGG - Intergenic
1117307239 14:54488809-54488831 AGCGGCCGCCGAGCCCTCCTGGG + Intronic
1117566820 14:57001809-57001831 GCCTGCCATTGAGTCCTCCCTGG + Intergenic
1118751482 14:68811010-68811032 GTCTGGCACTGCCCCCTCCTAGG + Intergenic
1119175699 14:72566288-72566310 AGCTGGCTCTGAGCCCTCATCGG - Intronic
1121823927 14:96995031-96995053 TGCTTCCACTGACCTCTCCTTGG - Intergenic
1122576986 14:102749008-102749030 GGGTGCCACGCAGCCCTCCCAGG - Intergenic
1122997704 14:105274502-105274524 GGAGGCCACTGCGCCCTCCTAGG + Intronic
1123685268 15:22792627-22792649 GGCTCCCACTGTGCCCAGCTTGG + Intronic
1124448804 15:29765605-29765627 GGAAGCCACTGTGCCCTGCTGGG - Intronic
1126323277 15:47447711-47447733 GGTTCCCACTGCCCCCTCCTTGG - Intronic
1126667348 15:51087290-51087312 AGCTGCCACAGAGGCCTGCTGGG + Intronic
1127325014 15:57886398-57886420 AGGTCCCACTGAGCCCTTCTTGG + Intergenic
1127827449 15:62717583-62717605 GGCTGCCGCTGCGGCCTGCTTGG - Exonic
1128222504 15:65979231-65979253 GGCTGCATCTGTGACCTCCTGGG - Intronic
1128454892 15:67826905-67826927 CGCCGCCACCGGGCCCTCCTGGG - Exonic
1129522863 15:76196721-76196743 GGCTGGCACCCCGCCCTCCTGGG - Intronic
1129604891 15:77020019-77020041 GGCTCCCATTGTGCCCTGCTGGG - Intronic
1129682170 15:77664056-77664078 AGCTGCCACAGAGCCTTCCCTGG + Intronic
1131545503 15:93312703-93312725 GCCTGTCAGTGAGCACTCCTGGG + Intergenic
1132097481 15:98998325-98998347 GGCTGCAACTGTGCCAACCTGGG + Intronic
1132630324 16:914210-914232 GGCAGTCCCTGACCCCTCCTGGG + Intronic
1133044339 16:3078414-3078436 GGCTGCAACTGGGCCGTCCTCGG + Intronic
1133254551 16:4508667-4508689 AGCTTCCACTGAGGCCTCCCAGG + Intronic
1134133692 16:11666499-11666521 GGCTGCCGCTGAACCCGCCCTGG + Intergenic
1134202370 16:12209712-12209734 GTCTGCTGCTCAGCCCTCCTCGG + Intronic
1136082964 16:27864928-27864950 GGCTCCCACTGAGTCCTACCGGG + Intronic
1137753035 16:50880604-50880626 TGCTGCCACTTAGCACTACTTGG - Intergenic
1137961419 16:52885456-52885478 GGCAAATACTGAGCCCTCCTGGG + Intergenic
1140640608 16:76967504-76967526 GGCTGACACTCAGGCCTCCAAGG - Intergenic
1141980498 16:87547261-87547283 AGCTGCCTCTGAGACCTCCTAGG + Intergenic
1142212734 16:88816180-88816202 GGCTGCCACTGCCATCTCCTGGG - Intronic
1142405411 16:89886054-89886076 GGCTGCCACAGAGACTTCGTGGG + Intronic
1142974561 17:3635970-3635992 GGCTGTCAGGGAGGCCTCCTGGG + Intronic
1143692931 17:8586057-8586079 AGCTGCCACTGACCCCTCCCAGG + Intronic
1144946700 17:18973080-18973102 GGCTGGCCCTCAGCCCTCCCAGG - Intronic
1148002130 17:44395446-44395468 GGCTGCCTCTTTGCCTTCCTAGG - Intronic
1148215313 17:45830843-45830865 GGCTGTCACAGAGCCCTCAGCGG - Intronic
1148995793 17:51708485-51708507 AGCTGCCACTCAGCACACCTGGG - Intronic
1152774727 17:82193939-82193961 GGCTGCCACAGAGCACGCCTCGG + Intronic
1152814620 17:82400061-82400083 GGCCTCCTCTGAGTCCTCCTGGG + Intronic
1152929406 17:83102195-83102217 GGCTGCATCTGGGCCCTCCCTGG - Intergenic
1153687393 18:7560136-7560158 GCCTGACACTGAGGCCACCTGGG - Intergenic
1155325466 18:24660218-24660240 GTCTCCCACTTAGCCCACCTTGG + Intergenic
1158929180 18:62304423-62304445 TGCTGCCACGGAGCACACCTGGG - Intronic
1160957059 19:1698675-1698697 GGCTGGCCCTCAGCCCTCCCTGG + Intergenic
1161393635 19:4033622-4033644 GGGTGCCACCGAGACCTCCACGG - Intronic
1161436852 19:4268685-4268707 GGCAGCAACTGAGCCCTCCCAGG + Exonic
1161925103 19:7294037-7294059 GGCTGCCTCTGGGCCCTCCCCGG - Intergenic
1162274084 19:9639360-9639382 GGATACCACTATGCCCTCCTTGG - Intronic
1162432306 19:10636398-10636420 GGCTACCACCGGGCCCTGCTGGG + Exonic
1162855955 19:13468852-13468874 GGCTGCCAGTGGCCCCACCTTGG - Intronic
1163587647 19:18172856-18172878 ACCTGCCTCTGAGCCCTCCATGG + Exonic
1163617451 19:18338001-18338023 GACTGCCCCTGAGCCCTGTTTGG - Intergenic
1163688186 19:18724195-18724217 AGCTGTCACTGCTCCCTCCTGGG - Intronic
1163725933 19:18923006-18923028 GGGTGTCACTGAGCTTTCCTGGG + Intronic
1165449644 19:35874619-35874641 GGCTGCCAGGAAGCCCTCCAAGG - Exonic
1165831709 19:38733828-38733850 GGCTGCCAATGGGGCCTCCCAGG + Intronic
1166822764 19:45590819-45590841 GGCGGCCACTCCGCCCTCCCAGG - Exonic
1167067756 19:47199663-47199685 GGCAGCCACTGAGCATACCTGGG - Intronic
1168003645 19:53468288-53468310 GGCTTCCCCTGAGCCCACGTTGG + Intronic
1168514739 19:57001963-57001985 GGTTTCCCCTGAGGCCTCCTTGG + Intergenic
925398322 2:3552925-3552947 TGCACCCTCTGAGCCCTCCTAGG - Intronic
925907169 2:8546338-8546360 GGTTTGCACTGAGCCCACCTTGG + Intergenic
927851685 2:26503675-26503697 GGCTGCCAAAAGGCCCTCCTGGG - Intronic
929587411 2:43125278-43125300 GGCTGTCTCTGTGCCCTCCTGGG - Intergenic
932452879 2:71827017-71827039 GGCTGCCGCCCAGGCCTCCTAGG + Intergenic
932713150 2:74082464-74082486 GGGTGTCACTGAGCCCTGGTGGG + Intronic
933852913 2:86385395-86385417 CTCTGCCCCTGAGGCCTCCTGGG + Intergenic
933898722 2:86834147-86834169 GACTGTCACTCAGCACTCCTGGG - Intronic
934474878 2:94587242-94587264 GCCTGCCTCTCAGCCCTCCCAGG - Intergenic
934674276 2:96238582-96238604 GTGAGCCACTGAGCCCGCCTCGG - Intergenic
937287113 2:120760645-120760667 TGGTGCCACTGAGCCTTGCTTGG + Intronic
937883568 2:126885801-126885823 TGCTGCTACTGTTCCCTCCTGGG + Intergenic
937903518 2:127040308-127040330 GGCAGCCACGGTGCCCTCCAGGG + Intergenic
937968571 2:127533292-127533314 GGCTGAGACTGAGTCCTCTTCGG - Intergenic
939883958 2:147660898-147660920 GGTTGCCACTAATCCCTCCTTGG + Intergenic
942067867 2:172288832-172288854 GCTTGCCACTGAGTCATCCTGGG + Intergenic
942155624 2:173124416-173124438 GGCTGTGACTGAGACCTCATTGG + Intronic
943858281 2:192827869-192827891 GGCTGGGGCTGAGCCCTCCTGGG + Intergenic
944906702 2:204269097-204269119 AGCTGCCACTGTCCCCTCCCAGG - Intergenic
946161063 2:217836345-217836367 GTCTTCCCCTCAGCCCTCCTGGG + Intronic
948425662 2:237885422-237885444 GGCTGCCTCGGTGCCCTCGTGGG + Intronic
948790608 2:240374649-240374671 GGCTGCCACCAGACCCTCCTCGG - Intergenic
948855345 2:240727709-240727731 GGCTGGCCCTGAGCCACCCTGGG - Intronic
1168938365 20:1687282-1687304 GGAAGTCACTGGGCCCTCCTAGG + Intergenic
1169358710 20:4929317-4929339 GGCTGACACTGGGACCTGCTGGG + Intronic
1170568845 20:17621689-17621711 AGCTCCCGCGGAGCCCTCCTCGG - Exonic
1172007424 20:31826956-31826978 GGCTGCCCCTGACCCTTCCCAGG - Intronic
1173894059 20:46536963-46536985 GGCTGCCACGGGACCATCCTAGG - Intergenic
1175607515 20:60323079-60323101 GGCTGCCACTGAGACCGTCCTGG - Intergenic
1175888695 20:62306534-62306556 GGCTGCCCCTGAACCCTACAGGG - Intronic
1175909165 20:62396457-62396479 GGCTGCCACTGACCCCTGCGGGG - Intronic
1176218629 20:63959690-63959712 GGCTGCCACAGGGCACACCTGGG - Exonic
1176382365 21:6119805-6119827 GGGTGCCACTGAGCCCCGCGGGG - Exonic
1179494663 21:41764093-41764115 GCCTGCCAGGGGGCCCTCCTGGG - Intronic
1179502641 21:41819840-41819862 GGCCTCCACAGAGCCCTCCCGGG + Intronic
1179741107 21:43418434-43418456 GGGTGCCACTGAGCCCCGCGGGG + Exonic
1179790841 21:43755069-43755091 GCCTGGCAGTGAGGCCTCCTCGG - Intronic
1179926693 21:44538798-44538820 AGCTGGGACTGAGCCTTCCTGGG + Intronic
1182041903 22:27244740-27244762 GGTTGCAACTGAGCCCACATGGG + Intergenic
1182162351 22:28135498-28135520 GTCTGCCACACAGCCTTCCTGGG - Intronic
1183302517 22:37065310-37065332 CACTGCCACTGAGCCCACCTTGG + Intergenic
1183363566 22:37395585-37395607 GGCTGCCACAGAGCCAGCCAAGG - Intronic
1183480904 22:38065024-38065046 AGCTGCCACTGTGCCGTCCAAGG - Exonic
1183538709 22:38417542-38417564 GGCTGCCACTCTGCCCACCCGGG + Intergenic
1183732405 22:39626023-39626045 GGCTGCCCCTGAGCTCCCCAGGG - Intronic
1184805640 22:46793303-46793325 TCCTGCCACTGAGTCCTCATGGG + Intronic
1184943084 22:47782922-47782944 GGCTGCTCCTCAGACCTCCTTGG - Intergenic
1185074504 22:48676093-48676115 GGCTGCCTGTGAGCCCTCTGGGG - Intronic
1185334696 22:50266332-50266354 GCCAGCCACAGACCCCTCCTGGG + Intronic
950054280 3:10012302-10012324 GGCTCCCTTTGAGCCCTCTTTGG - Intergenic
950416215 3:12870223-12870245 GGCTCCCTTTGAGCCCTCTTTGG - Intronic
950688339 3:14635397-14635419 CGCAGCCCCTGGGCCCTCCTGGG + Intergenic
950715775 3:14846749-14846771 GGCAGTCACTCAGCCCCCCTGGG + Intronic
952436502 3:33277394-33277416 GGCCGCCTCCGAGCCCACCTTGG + Intronic
952865579 3:37853134-37853156 CCCTGCCACACAGCCCTCCTTGG - Intergenic
952902059 3:38117129-38117151 CGCAGCCACTGCTCCCTCCTGGG + Intronic
954254817 3:49397052-49397074 CACTGCCACTTTGCCCTCCTGGG - Intronic
954431988 3:50475778-50475800 TGCGTCCACTGACCCCTCCTGGG + Intronic
954745935 3:52787603-52787625 GGCTGCCACTTACTCCTTCTGGG - Exonic
956701263 3:71961038-71961060 AGATGCCACTGAGTCCCCCTTGG + Intergenic
957809053 3:85193871-85193893 GGCTCTCCTTGAGCCCTCCTAGG - Intronic
961412526 3:126733141-126733163 GGCTGCCACCAAGCACTCCAAGG + Exonic
963272892 3:143302967-143302989 GGCTGCCAAGAAGCCCTCCGTGG - Intronic
967146800 3:186613184-186613206 GGCTGCCACTCAGCCCCACATGG + Exonic
968266574 3:197367650-197367672 GGCTGGCACGAAGCCCTGCTGGG + Intergenic
968298988 3:197599147-197599169 TCCTGCCTCTGAGCCCTGCTGGG - Intergenic
968497916 4:928591-928613 CCCTGCCACTGAGCCCACCTTGG + Intronic
968497927 4:928627-928649 TCCTGCCACTGAGCCCACCTGGG + Intronic
969313819 4:6369833-6369855 AGCAGCCCCTGAGCCCTCCAGGG + Intronic
969609112 4:8217116-8217138 GGCCGCCACTGCCACCTCCTCGG - Exonic
970476196 4:16426569-16426591 AGCTTCCACTGATACCTCCTTGG + Intergenic
970502668 4:16694052-16694074 GGCTGCAACGGACCCCTTCTGGG + Intronic
971160222 4:24126467-24126489 GGCTTCTACTCAGTCCTCCTGGG - Intergenic
974603728 4:64122504-64122526 GGCTGACTCTGTGCCCTCCAAGG + Intergenic
977652657 4:99487969-99487991 GGCTGCCACTGGGGGGTCCTTGG + Intergenic
978957396 4:114631197-114631219 GTGAGCCACTGAGCCCTGCTGGG - Intronic
981529492 4:145738165-145738187 GTGAGCCACTGAGCCCTGCTGGG - Intronic
981914864 4:150022845-150022867 TCCTGCCACAGAGCCCTACTTGG - Intergenic
985646409 5:1086760-1086782 GGCTGCCCCTGGGCTCTCCTGGG - Intronic
986251011 5:6058649-6058671 CACTGCCTCTGAGCTCTCCTTGG + Intergenic
986284095 5:6347327-6347349 GGCTGGCACTGAGCAAGCCTCGG - Intergenic
987116189 5:14728638-14728660 AGCTGTCACTCAGCCCTCTTGGG - Intronic
988683374 5:33504033-33504055 GGCTTTCACTGAGCCCAACTTGG - Intergenic
989261253 5:39422376-39422398 TGCTGAGAGTGAGCCCTCCTGGG - Intronic
990024748 5:51172907-51172929 AGGTGCCACTGTGCCCTGCTGGG - Intergenic
990942427 5:61215950-61215972 GGCTGCCTCTGGGCTCTTCTGGG + Intergenic
993520067 5:88889519-88889541 GGCAGGCTCTGGGCCCTCCTGGG + Intronic
996230599 5:121059252-121059274 GGCTGCTACTGAGACCTGCGTGG + Intergenic
996291488 5:121857372-121857394 GGCTGCAACTGAGGGGTCCTGGG + Intergenic
997853188 5:137351019-137351041 ACCTGCCACTGAGCCCTAGTTGG - Intronic
998148212 5:139742452-139742474 GGCTGCCACTGAGGCCTGGAGGG - Intergenic
998388992 5:141774778-141774800 GGCTGCCACTGACTGCTCTTGGG - Intergenic
999085435 5:148884599-148884621 TGCTGCCACTTAGCCTTCCTGGG - Intergenic
999257397 5:150217187-150217209 GCTTATCACTGAGCCCTCCTTGG + Intronic
1000560170 5:162777499-162777521 GGCCTCCACTGATGCCTCCTTGG + Intergenic
1001301207 5:170535114-170535136 TGCTGCCCCTGACCTCTCCTAGG - Intronic
1002061732 5:176629601-176629623 GGCTGCCACAACGCCCTCCTTGG + Exonic
1002410214 5:179068854-179068876 GGCTTCTCCTGAGGCCTCCTTGG + Intronic
1002852445 6:1008395-1008417 GGCAGCTCCTGAGCCTTCCTCGG - Intergenic
1003958808 6:11190687-11190709 GGCTGACAGTGAGGACTCCTTGG + Exonic
1004171433 6:13298417-13298439 AGCTGCCACAGAGCTGTCCTTGG + Intronic
1004546763 6:16605426-16605448 GGCTGCCCATGAGCCCTGCAAGG + Intronic
1005140833 6:22629713-22629735 GGTTGACACTGAGCCCAGCTGGG - Intergenic
1006111294 6:31747247-31747269 GGCTGCCTTTGTGCCCTCCCAGG + Intronic
1006887551 6:37395231-37395253 GGCTTCCACAGAGGTCTCCTGGG - Intergenic
1007289612 6:40775525-40775547 GGCAGCCTGTGAGCACTCCTGGG + Intergenic
1010325343 6:74556727-74556749 ATCTGCCACTGACACCTCCTTGG + Intergenic
1011019546 6:82796957-82796979 GGCTGGGACTGAGCATTCCTAGG - Intergenic
1014200132 6:118600277-118600299 GCCTGTCCCTGAGCCTTCCTGGG + Intronic
1014964727 6:127733478-127733500 GGGTGCCACTGTGCACCCCTAGG + Intronic
1016880885 6:148911049-148911071 GGCTGGCCCTGACCCCTCCAGGG + Intronic
1018421959 6:163647732-163647754 GGCTGCATCTCAGACCTCCTGGG + Intergenic
1018457407 6:163964352-163964374 GGCTGTCACTGAGCTCCCCTGGG + Intergenic
1021043241 7:15889753-15889775 AGCTTCCCCTGAGCCATCCTTGG + Intergenic
1021811772 7:24409371-24409393 GGCTGCCCCTGAGCCCTCAGCGG - Intergenic
1021838765 7:24705837-24705859 TGCTGCCACTCAGCTCTGCTGGG + Intronic
1022092715 7:27117903-27117925 GGGGGCCACTGGGCCCACCTAGG + Intronic
1023777102 7:43618208-43618230 GGCAGCCATTAAGCCCTCCCTGG + Intronic
1024123482 7:46268252-46268274 GGCTGCCAGTGTGGCCCCCTGGG + Intergenic
1024136185 7:46411719-46411741 GGCAGCTCCTGTGCCCTCCTTGG + Intergenic
1024533274 7:50410338-50410360 CGCAGCCACTGAGGCCTTCTGGG - Intergenic
1024864627 7:53891030-53891052 AGCTGCCACAAAGCCCTGCTGGG + Intergenic
1025102681 7:56149338-56149360 GGCTGCAACTGAGGGGTCCTTGG - Intergenic
1025850589 7:65240077-65240099 GGCGGCTGCAGAGCCCTCCTGGG + Intergenic
1025965047 7:66262040-66262062 TGCTCTCTCTGAGCCCTCCTTGG + Intronic
1027035596 7:74922863-74922885 GGCTGAGACTCAGCCTTCCTGGG + Intergenic
1027265700 7:76494163-76494185 GGGTGCCCCTGACCCCTCGTGGG + Intronic
1027317070 7:76992280-76992302 GGGTGCCCCTGACCCCTCGTGGG + Intergenic
1029394462 7:100298274-100298296 GGCTGAGACTCAGCCTTCCTGGG - Intergenic
1029644720 7:101846715-101846737 GGCTGCCACTAGCACCTCCTTGG - Intronic
1033236611 7:139642802-139642824 GGCTTCCACGGAGCCATCCTTGG + Intronic
1034250957 7:149690485-149690507 GTCTGCCATGGAGACCTCCTAGG - Intergenic
1034268820 7:149793599-149793621 TGCTGCCACTGTGCCCTACCTGG + Intergenic
1034422744 7:150997920-150997942 GGCTGCACCAGAGGCCTCCTAGG - Intronic
1035049141 7:155988488-155988510 GTCCACCACTGAGCTCTCCTTGG + Intergenic
1035555741 8:565849-565871 GGGGGTCTCTGAGCCCTCCTTGG - Intergenic
1036494331 8:9255749-9255771 TGCTTCCACTGGGCCCTCCAGGG + Intergenic
1038676095 8:29624201-29624223 AGATGCCCCTGAGCCATCCTTGG - Intergenic
1039790068 8:40868551-40868573 GGCTGCCACTGAGCCCTCCTTGG - Intronic
1042958923 8:74281857-74281879 GGCTGCCATTCAGCTCTCCTGGG - Intronic
1045092592 8:98761935-98761957 GGGTGTCACTGAGCACCCCTTGG - Intronic
1047308370 8:123671759-123671781 GGCTGTCACTGAGTGCTCCTTGG - Intergenic
1048354703 8:133643494-133643516 TGCTGCCTCTGGGCCCTCCAGGG - Intergenic
1048472651 8:134717338-134717360 GGCTGCCACTCAGTGCACCTGGG + Intergenic
1049401803 8:142431199-142431221 GGCAGCCACAGCTCCCTCCTTGG + Intergenic
1052409263 9:28102075-28102097 GGCTGCCACAGAGACCACGTTGG + Intronic
1052497017 9:29239964-29239986 GGATGCCACTGAGGACTTCTGGG + Intergenic
1053050978 9:34960011-34960033 GACTCCCAGTGAGCCTTCCTTGG - Intronic
1053933169 9:43127175-43127197 GCCTGCCTCTCAGCCCTCCCAGG + Intergenic
1054296294 9:63334357-63334379 GCCTGCCTCTCAGCCCTCCCAGG + Intergenic
1054394311 9:64638862-64638884 GCCTGCCTCTCAGCCCTCCCAGG + Intergenic
1054428960 9:65144061-65144083 GCCTGCCTCTCAGCCCTCCCAGG + Intergenic
1057224789 9:93287220-93287242 GGCAGCCTCTGAGCACCCCTAGG - Intronic
1057560912 9:96127158-96127180 GGCTGCCACACAGGCCTCCAGGG - Intergenic
1058823014 9:108749756-108749778 GCCTGCCTCTTAGCCCTCCCAGG + Intergenic
1060129512 9:121081542-121081564 GACTCCCACTGCCCCCTCCTTGG + Intronic
1061602986 9:131684851-131684873 GGCTGCAACTGAGGGGTCCTTGG - Intronic
1062209762 9:135357164-135357186 GGCTGGCTCTGAGCCCTTCAGGG - Intergenic
1062248592 9:135583149-135583171 GGCAGGCACTCAGCCCTCCTGGG + Intergenic
1188003903 X:25004817-25004839 CGATGCCACTGCGCCCTCCACGG + Exonic
1188725873 X:33580868-33580890 GGCTGCCACTGAGGTTTCTTCGG + Intergenic
1190296181 X:49029321-49029343 GGTTGGCTCAGAGCCCTCCTAGG + Exonic
1190320066 X:49174844-49174866 GCCTGCCAATCAACCCTCCTGGG + Exonic
1197703102 X:129614832-129614854 GGCACCCACTCATCCCTCCTGGG + Intergenic
1198479778 X:137030838-137030860 GGCTTCCATTCTGCCCTCCTTGG + Exonic
1199499940 X:148498160-148498182 GGCTGTCCCTGAGGCCTCTTTGG - Intergenic
1199769980 X:150969112-150969134 GGCTGCCACAGGGCCCAGCTGGG - Intergenic
1200037909 X:153345313-153345335 GGCAGCCTCTGGGCCCACCTTGG - Intronic
1200282123 X:154785912-154785934 TGCTGGGACTGAGCCCTCCCTGG - Intronic
1202266165 Y:23021358-23021380 GTCTCCAACTGAGCACTCCTTGG - Intergenic
1202419158 Y:24655101-24655123 GTCTCCAACTGAGCACTCCTTGG - Intergenic
1202451628 Y:25014983-25015005 GTCTCCAACTGAGCACTCCTTGG + Intergenic