ID: 1039791010

View in Genome Browser
Species Human (GRCh38)
Location 8:40875596-40875618
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039791002_1039791010 24 Left 1039791002 8:40875549-40875571 CCAAATTGGAAAGAACAGTGGGA 0: 1
1: 0
2: 1
3: 24
4: 276
Right 1039791010 8:40875596-40875618 TGTGGTATCTTCATGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr