ID: 1039792527

View in Genome Browser
Species Human (GRCh38)
Location 8:40887191-40887213
Sequence CCACCGTGCCTGGCCAAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3433
Summary {0: 1, 1: 29, 2: 183, 3: 840, 4: 2380}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039792527_1039792537 25 Left 1039792527 8:40887191-40887213 CCGGTTTTGGCCAGGCACGGTGG 0: 1
1: 29
2: 183
3: 840
4: 2380
Right 1039792537 8:40887239-40887261 AACACTTTGGGAGCCTGAGGAGG 0: 53
1: 5488
2: 75459
3: 160682
4: 157627
1039792527_1039792532 13 Left 1039792527 8:40887191-40887213 CCGGTTTTGGCCAGGCACGGTGG 0: 1
1: 29
2: 183
3: 840
4: 2380
Right 1039792532 8:40887227-40887249 TCCTGTAATCCCAACACTTTGGG 0: 444
1: 29533
2: 325159
3: 264095
4: 138845
1039792527_1039792538 26 Left 1039792527 8:40887191-40887213 CCGGTTTTGGCCAGGCACGGTGG 0: 1
1: 29
2: 183
3: 840
4: 2380
Right 1039792538 8:40887240-40887262 ACACTTTGGGAGCCTGAGGAGGG 0: 5
1: 395
2: 12930
3: 123930
4: 242210
1039792527_1039792539 29 Left 1039792527 8:40887191-40887213 CCGGTTTTGGCCAGGCACGGTGG 0: 1
1: 29
2: 183
3: 840
4: 2380
Right 1039792539 8:40887243-40887265 CTTTGGGAGCCTGAGGAGGGTGG 0: 23
1: 2356
2: 52613
3: 149338
4: 187347
1039792527_1039792531 12 Left 1039792527 8:40887191-40887213 CCGGTTTTGGCCAGGCACGGTGG 0: 1
1: 29
2: 183
3: 840
4: 2380
Right 1039792531 8:40887226-40887248 ATCCTGTAATCCCAACACTTTGG 0: 21
1: 1164
2: 39135
3: 334250
4: 260755
1039792527_1039792535 22 Left 1039792527 8:40887191-40887213 CCGGTTTTGGCCAGGCACGGTGG 0: 1
1: 29
2: 183
3: 840
4: 2380
Right 1039792535 8:40887236-40887258 CCCAACACTTTGGGAGCCTGAGG 0: 79
1: 7977
2: 106011
3: 225820
4: 241520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039792527 Original CRISPR CCACCGTGCCTGGCCAAAAC CGG (reversed) Intronic
Too many off-targets to display for this crispr