ID: 1039795241

View in Genome Browser
Species Human (GRCh38)
Location 8:40907314-40907336
Sequence CACTCAAGACCTTCAGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039795241_1039795243 8 Left 1039795241 8:40907314-40907336 CCTGATGCTGAAGGTCTTGAGTG No data
Right 1039795243 8:40907345-40907367 ACAAAAGTTCGTCAGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039795241 Original CRISPR CACTCAAGACCTTCAGCATC AGG (reversed) Intergenic
No off target data available for this crispr