ID: 1039795243

View in Genome Browser
Species Human (GRCh38)
Location 8:40907345-40907367
Sequence ACAAAAGTTCGTCAGAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039795240_1039795243 14 Left 1039795240 8:40907308-40907330 CCTCATCCTGATGCTGAAGGTCT No data
Right 1039795243 8:40907345-40907367 ACAAAAGTTCGTCAGAGTCCTGG No data
1039795241_1039795243 8 Left 1039795241 8:40907314-40907336 CCTGATGCTGAAGGTCTTGAGTG No data
Right 1039795243 8:40907345-40907367 ACAAAAGTTCGTCAGAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039795243 Original CRISPR ACAAAAGTTCGTCAGAGTCC TGG Intergenic
No off target data available for this crispr