ID: 1039797708

View in Genome Browser
Species Human (GRCh38)
Location 8:40929361-40929383
Sequence GATCTTAGCAGACCATCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039797708_1039797713 5 Left 1039797708 8:40929361-40929383 CCTTCTGATGGTCTGCTAAGATC No data
Right 1039797713 8:40929389-40929411 TCTCAGAGTGCTTACAGGGGTGG No data
1039797708_1039797715 10 Left 1039797708 8:40929361-40929383 CCTTCTGATGGTCTGCTAAGATC No data
Right 1039797715 8:40929394-40929416 GAGTGCTTACAGGGGTGGATGGG No data
1039797708_1039797717 17 Left 1039797708 8:40929361-40929383 CCTTCTGATGGTCTGCTAAGATC No data
Right 1039797717 8:40929401-40929423 TACAGGGGTGGATGGGATGTGGG No data
1039797708_1039797716 16 Left 1039797708 8:40929361-40929383 CCTTCTGATGGTCTGCTAAGATC No data
Right 1039797716 8:40929400-40929422 TTACAGGGGTGGATGGGATGTGG No data
1039797708_1039797712 2 Left 1039797708 8:40929361-40929383 CCTTCTGATGGTCTGCTAAGATC No data
Right 1039797712 8:40929386-40929408 AGGTCTCAGAGTGCTTACAGGGG No data
1039797708_1039797714 9 Left 1039797708 8:40929361-40929383 CCTTCTGATGGTCTGCTAAGATC No data
Right 1039797714 8:40929393-40929415 AGAGTGCTTACAGGGGTGGATGG No data
1039797708_1039797718 24 Left 1039797708 8:40929361-40929383 CCTTCTGATGGTCTGCTAAGATC No data
Right 1039797718 8:40929408-40929430 GTGGATGGGATGTGGGACTTTGG No data
1039797708_1039797710 0 Left 1039797708 8:40929361-40929383 CCTTCTGATGGTCTGCTAAGATC No data
Right 1039797710 8:40929384-40929406 ACAGGTCTCAGAGTGCTTACAGG No data
1039797708_1039797711 1 Left 1039797708 8:40929361-40929383 CCTTCTGATGGTCTGCTAAGATC No data
Right 1039797711 8:40929385-40929407 CAGGTCTCAGAGTGCTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039797708 Original CRISPR GATCTTAGCAGACCATCAGA AGG (reversed) Intergenic
No off target data available for this crispr