ID: 1039798648

View in Genome Browser
Species Human (GRCh38)
Location 8:40935996-40936018
Sequence GGTGTCTCCTTGTGTGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039798648_1039798652 5 Left 1039798648 8:40935996-40936018 CCCGTTTCACACAAGGAGACACC No data
Right 1039798652 8:40936024-40936046 TTGTTGGCAGCATGTTTGCCTGG No data
1039798648_1039798655 28 Left 1039798648 8:40935996-40936018 CCCGTTTCACACAAGGAGACACC No data
Right 1039798655 8:40936047-40936069 ATGCCATATTTCTCAAACGGTGG No data
1039798648_1039798654 25 Left 1039798648 8:40935996-40936018 CCCGTTTCACACAAGGAGACACC No data
Right 1039798654 8:40936044-40936066 TGGATGCCATATTTCTCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039798648 Original CRISPR GGTGTCTCCTTGTGTGAAAC GGG (reversed) Intergenic
No off target data available for this crispr