ID: 1039798655

View in Genome Browser
Species Human (GRCh38)
Location 8:40936047-40936069
Sequence ATGCCATATTTCTCAAACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039798648_1039798655 28 Left 1039798648 8:40935996-40936018 CCCGTTTCACACAAGGAGACACC No data
Right 1039798655 8:40936047-40936069 ATGCCATATTTCTCAAACGGTGG No data
1039798651_1039798655 7 Left 1039798651 8:40936017-40936039 CCACAGTTTGTTGGCAGCATGTT No data
Right 1039798655 8:40936047-40936069 ATGCCATATTTCTCAAACGGTGG No data
1039798649_1039798655 27 Left 1039798649 8:40935997-40936019 CCGTTTCACACAAGGAGACACCA No data
Right 1039798655 8:40936047-40936069 ATGCCATATTTCTCAAACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039798655 Original CRISPR ATGCCATATTTCTCAAACGG TGG Intergenic
No off target data available for this crispr