ID: 1039799792

View in Genome Browser
Species Human (GRCh38)
Location 8:40944358-40944380
Sequence CCTTCTGAGGAGCAGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039799792_1039799797 0 Left 1039799792 8:40944358-40944380 CCTTCTCTCTGCTCCTCAGAAGG No data
Right 1039799797 8:40944381-40944403 GAGTTAGTCGGCAGATATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039799792 Original CRISPR CCTTCTGAGGAGCAGAGAGA AGG (reversed) Intergenic
No off target data available for this crispr