ID: 1039800138

View in Genome Browser
Species Human (GRCh38)
Location 8:40947142-40947164
Sequence AGGAACAAACAGATGAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039800130_1039800138 26 Left 1039800130 8:40947093-40947115 CCAGAAAATACTTTAAAAATGGA No data
Right 1039800138 8:40947142-40947164 AGGAACAAACAGATGAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039800138 Original CRISPR AGGAACAAACAGATGAGCTA TGG Intergenic
No off target data available for this crispr