ID: 1039800461

View in Genome Browser
Species Human (GRCh38)
Location 8:40950188-40950210
Sequence TTCCACTTCCTGGTCCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039800461_1039800466 8 Left 1039800461 8:40950188-40950210 CCATTGTGGACCAGGAAGTGGAA No data
Right 1039800466 8:40950219-40950241 TTAAGGGAAGTGGATCAACAAGG No data
1039800461_1039800465 -2 Left 1039800461 8:40950188-40950210 CCATTGTGGACCAGGAAGTGGAA No data
Right 1039800465 8:40950209-40950231 AAGCTGTGCATTAAGGGAAGTGG No data
1039800461_1039800467 28 Left 1039800461 8:40950188-40950210 CCATTGTGGACCAGGAAGTGGAA No data
Right 1039800467 8:40950239-40950261 AGGTAAGCCCCCCATCTCCCTGG No data
1039800461_1039800468 29 Left 1039800461 8:40950188-40950210 CCATTGTGGACCAGGAAGTGGAA No data
Right 1039800468 8:40950240-40950262 GGTAAGCCCCCCATCTCCCTGGG No data
1039800461_1039800463 -9 Left 1039800461 8:40950188-40950210 CCATTGTGGACCAGGAAGTGGAA No data
Right 1039800463 8:40950202-40950224 GAAGTGGAAGCTGTGCATTAAGG No data
1039800461_1039800464 -8 Left 1039800461 8:40950188-40950210 CCATTGTGGACCAGGAAGTGGAA No data
Right 1039800464 8:40950203-40950225 AAGTGGAAGCTGTGCATTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039800461 Original CRISPR TTCCACTTCCTGGTCCACAA TGG (reversed) Intergenic
No off target data available for this crispr