ID: 1039800462

View in Genome Browser
Species Human (GRCh38)
Location 8:40950198-40950220
Sequence AATGCACAGCTTCCACTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039800462_1039800468 19 Left 1039800462 8:40950198-40950220 CCAGGAAGTGGAAGCTGTGCATT No data
Right 1039800468 8:40950240-40950262 GGTAAGCCCCCCATCTCCCTGGG No data
1039800462_1039800466 -2 Left 1039800462 8:40950198-40950220 CCAGGAAGTGGAAGCTGTGCATT No data
Right 1039800466 8:40950219-40950241 TTAAGGGAAGTGGATCAACAAGG No data
1039800462_1039800469 24 Left 1039800462 8:40950198-40950220 CCAGGAAGTGGAAGCTGTGCATT No data
Right 1039800469 8:40950245-40950267 GCCCCCCATCTCCCTGGGCCAGG No data
1039800462_1039800467 18 Left 1039800462 8:40950198-40950220 CCAGGAAGTGGAAGCTGTGCATT No data
Right 1039800467 8:40950239-40950261 AGGTAAGCCCCCCATCTCCCTGG No data
1039800462_1039800471 25 Left 1039800462 8:40950198-40950220 CCAGGAAGTGGAAGCTGTGCATT No data
Right 1039800471 8:40950246-40950268 CCCCCCATCTCCCTGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039800462 Original CRISPR AATGCACAGCTTCCACTTCC TGG (reversed) Intergenic
No off target data available for this crispr