ID: 1039800466

View in Genome Browser
Species Human (GRCh38)
Location 8:40950219-40950241
Sequence TTAAGGGAAGTGGATCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039800462_1039800466 -2 Left 1039800462 8:40950198-40950220 CCAGGAAGTGGAAGCTGTGCATT No data
Right 1039800466 8:40950219-40950241 TTAAGGGAAGTGGATCAACAAGG No data
1039800461_1039800466 8 Left 1039800461 8:40950188-40950210 CCATTGTGGACCAGGAAGTGGAA No data
Right 1039800466 8:40950219-40950241 TTAAGGGAAGTGGATCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039800466 Original CRISPR TTAAGGGAAGTGGATCAACA AGG Intergenic
No off target data available for this crispr