ID: 1039800471

View in Genome Browser
Species Human (GRCh38)
Location 8:40950246-40950268
Sequence CCCCCCATCTCCCTGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039800462_1039800471 25 Left 1039800462 8:40950198-40950220 CCAGGAAGTGGAAGCTGTGCATT No data
Right 1039800471 8:40950246-40950268 CCCCCCATCTCCCTGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039800471 Original CRISPR CCCCCCATCTCCCTGGGCCA GGG Intergenic
No off target data available for this crispr