ID: 1039805646

View in Genome Browser
Species Human (GRCh38)
Location 8:40995192-40995214
Sequence CCTGACATAACACCCCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039805640_1039805646 15 Left 1039805640 8:40995154-40995176 CCAATCAGCAAGGCAAAACCTCA No data
Right 1039805646 8:40995192-40995214 CCTGACATAACACCCCTGGTAGG No data
1039805642_1039805646 -3 Left 1039805642 8:40995172-40995194 CCTCAGGACACTTTCTCTTCCCT No data
Right 1039805646 8:40995192-40995214 CCTGACATAACACCCCTGGTAGG No data
1039805639_1039805646 20 Left 1039805639 8:40995149-40995171 CCTTGCCAATCAGCAAGGCAAAA No data
Right 1039805646 8:40995192-40995214 CCTGACATAACACCCCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039805646 Original CRISPR CCTGACATAACACCCCTGGT AGG Intergenic
No off target data available for this crispr