ID: 1039806199

View in Genome Browser
Species Human (GRCh38)
Location 8:41001795-41001817
Sequence AAGAAGAAGAAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7563
Summary {0: 12, 1: 84, 2: 343, 3: 1478, 4: 5646}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039806199_1039806204 25 Left 1039806199 8:41001795-41001817 CCTTCTTCCTTCTTCTTCTTCTT 0: 12
1: 84
2: 343
3: 1478
4: 5646
Right 1039806204 8:41001843-41001865 AGGGTCTTGCTAGATTACCCAGG No data
1039806199_1039806205 29 Left 1039806199 8:41001795-41001817 CCTTCTTCCTTCTTCTTCTTCTT 0: 12
1: 84
2: 343
3: 1478
4: 5646
Right 1039806205 8:41001847-41001869 TCTTGCTAGATTACCCAGGCTGG 0: 2
1: 49
2: 1670
3: 14994
4: 89227
1039806199_1039806203 6 Left 1039806199 8:41001795-41001817 CCTTCTTCCTTCTTCTTCTTCTT 0: 12
1: 84
2: 343
3: 1478
4: 5646
Right 1039806203 8:41001824-41001846 TTTTAATTAAAATAGAGACAGGG No data
1039806199_1039806202 5 Left 1039806199 8:41001795-41001817 CCTTCTTCCTTCTTCTTCTTCTT 0: 12
1: 84
2: 343
3: 1478
4: 5646
Right 1039806202 8:41001823-41001845 TTTTTAATTAAAATAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039806199 Original CRISPR AAGAAGAAGAAGAAGGAAGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr