ID: 1039806203

View in Genome Browser
Species Human (GRCh38)
Location 8:41001824-41001846
Sequence TTTTAATTAAAATAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039806200_1039806203 -1 Left 1039806200 8:41001802-41001824 CCTTCTTCTTCTTCTTCCTTCTT 0: 9
1: 79
2: 482
3: 1824
4: 7473
Right 1039806203 8:41001824-41001846 TTTTAATTAAAATAGAGACAGGG No data
1039806198_1039806203 9 Left 1039806198 8:41001792-41001814 CCTCCTTCTTCCTTCTTCTTCTT No data
Right 1039806203 8:41001824-41001846 TTTTAATTAAAATAGAGACAGGG No data
1039806199_1039806203 6 Left 1039806199 8:41001795-41001817 CCTTCTTCCTTCTTCTTCTTCTT 0: 12
1: 84
2: 343
3: 1478
4: 5646
Right 1039806203 8:41001824-41001846 TTTTAATTAAAATAGAGACAGGG No data
1039806197_1039806203 17 Left 1039806197 8:41001784-41001806 CCTTTCTTCCTCCTTCTTCCTTC 0: 2
1: 18
2: 160
3: 1144
4: 5821
Right 1039806203 8:41001824-41001846 TTTTAATTAAAATAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039806203 Original CRISPR TTTTAATTAAAATAGAGACA GGG Intergenic
No off target data available for this crispr