ID: 1039806204

View in Genome Browser
Species Human (GRCh38)
Location 8:41001843-41001865
Sequence AGGGTCTTGCTAGATTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039806200_1039806204 18 Left 1039806200 8:41001802-41001824 CCTTCTTCTTCTTCTTCCTTCTT 0: 9
1: 79
2: 482
3: 1824
4: 7473
Right 1039806204 8:41001843-41001865 AGGGTCTTGCTAGATTACCCAGG No data
1039806199_1039806204 25 Left 1039806199 8:41001795-41001817 CCTTCTTCCTTCTTCTTCTTCTT 0: 12
1: 84
2: 343
3: 1478
4: 5646
Right 1039806204 8:41001843-41001865 AGGGTCTTGCTAGATTACCCAGG No data
1039806201_1039806204 2 Left 1039806201 8:41001818-41001840 CCTTCTTTTTAATTAAAATAGAG No data
Right 1039806204 8:41001843-41001865 AGGGTCTTGCTAGATTACCCAGG No data
1039806198_1039806204 28 Left 1039806198 8:41001792-41001814 CCTCCTTCTTCCTTCTTCTTCTT No data
Right 1039806204 8:41001843-41001865 AGGGTCTTGCTAGATTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039806204 Original CRISPR AGGGTCTTGCTAGATTACCC AGG Intergenic
No off target data available for this crispr