ID: 1039806205

View in Genome Browser
Species Human (GRCh38)
Location 8:41001847-41001869
Sequence TCTTGCTAGATTACCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105942
Summary {0: 2, 1: 49, 2: 1670, 3: 14994, 4: 89227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039806199_1039806205 29 Left 1039806199 8:41001795-41001817 CCTTCTTCCTTCTTCTTCTTCTT 0: 12
1: 84
2: 343
3: 1478
4: 5646
Right 1039806205 8:41001847-41001869 TCTTGCTAGATTACCCAGGCTGG 0: 2
1: 49
2: 1670
3: 14994
4: 89227
1039806200_1039806205 22 Left 1039806200 8:41001802-41001824 CCTTCTTCTTCTTCTTCCTTCTT 0: 9
1: 79
2: 482
3: 1824
4: 7473
Right 1039806205 8:41001847-41001869 TCTTGCTAGATTACCCAGGCTGG 0: 2
1: 49
2: 1670
3: 14994
4: 89227
1039806201_1039806205 6 Left 1039806201 8:41001818-41001840 CCTTCTTTTTAATTAAAATAGAG No data
Right 1039806205 8:41001847-41001869 TCTTGCTAGATTACCCAGGCTGG 0: 2
1: 49
2: 1670
3: 14994
4: 89227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039806205 Original CRISPR TCTTGCTAGATTACCCAGGC TGG Intergenic
Too many off-targets to display for this crispr