ID: 1039806937

View in Genome Browser
Species Human (GRCh38)
Location 8:41008157-41008179
Sequence ACCCATTGCTGGTCTCACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039806937_1039806941 27 Left 1039806937 8:41008157-41008179 CCAATGTGAGACCAGCAATGGGT No data
Right 1039806941 8:41008207-41008229 GTATAACCATTTCCCAGCACTGG No data
1039806937_1039806939 -8 Left 1039806937 8:41008157-41008179 CCAATGTGAGACCAGCAATGGGT No data
Right 1039806939 8:41008172-41008194 CAATGGGTTTGAAATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039806937 Original CRISPR ACCCATTGCTGGTCTCACAT TGG (reversed) Intergenic
No off target data available for this crispr