ID: 1039806939

View in Genome Browser
Species Human (GRCh38)
Location 8:41008172-41008194
Sequence CAATGGGTTTGAAATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039806937_1039806939 -8 Left 1039806937 8:41008157-41008179 CCAATGTGAGACCAGCAATGGGT No data
Right 1039806939 8:41008172-41008194 CAATGGGTTTGAAATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039806939 Original CRISPR CAATGGGTTTGAAATGAAGA AGG Intergenic
No off target data available for this crispr