ID: 1039809350

View in Genome Browser
Species Human (GRCh38)
Location 8:41031947-41031969
Sequence AGTTATTTTAAGAAGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039809350_1039809352 5 Left 1039809350 8:41031947-41031969 CCTACAATCTTCTTAAAATAACT No data
Right 1039809352 8:41031975-41031997 AGTAACTTTTGAAATACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039809350 Original CRISPR AGTTATTTTAAGAAGATTGT AGG (reversed) Intergenic
No off target data available for this crispr