ID: 1039811613

View in Genome Browser
Species Human (GRCh38)
Location 8:41054198-41054220
Sequence GGGTAGTGAGATATCTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039811613_1039811618 8 Left 1039811613 8:41054198-41054220 CCACCCTAGATATCTCACTACCC No data
Right 1039811618 8:41054229-41054251 TTATCACCTTGACCTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039811613 Original CRISPR GGGTAGTGAGATATCTAGGG TGG (reversed) Intergenic
No off target data available for this crispr