ID: 1039816336

View in Genome Browser
Species Human (GRCh38)
Location 8:41097874-41097896
Sequence CTCACTGGGATGTTTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039816336_1039816343 13 Left 1039816336 8:41097874-41097896 CCAGTGAGAAACATCCCAGTGAG No data
Right 1039816343 8:41097910-41097932 CGTTCTGGGAAGTGGGAGACAGG No data
1039816336_1039816344 14 Left 1039816336 8:41097874-41097896 CCAGTGAGAAACATCCCAGTGAG No data
Right 1039816344 8:41097911-41097933 GTTCTGGGAAGTGGGAGACAGGG No data
1039816336_1039816341 5 Left 1039816336 8:41097874-41097896 CCAGTGAGAAACATCCCAGTGAG No data
Right 1039816341 8:41097902-41097924 TCAGCAATCGTTCTGGGAAGTGG No data
1039816336_1039816347 22 Left 1039816336 8:41097874-41097896 CCAGTGAGAAACATCCCAGTGAG No data
Right 1039816347 8:41097919-41097941 AAGTGGGAGACAGGGGGTACCGG No data
1039816336_1039816339 -2 Left 1039816336 8:41097874-41097896 CCAGTGAGAAACATCCCAGTGAG No data
Right 1039816339 8:41097895-41097917 AGTTTTATCAGCAATCGTTCTGG No data
1039816336_1039816340 -1 Left 1039816336 8:41097874-41097896 CCAGTGAGAAACATCCCAGTGAG No data
Right 1039816340 8:41097896-41097918 GTTTTATCAGCAATCGTTCTGGG No data
1039816336_1039816348 23 Left 1039816336 8:41097874-41097896 CCAGTGAGAAACATCCCAGTGAG No data
Right 1039816348 8:41097920-41097942 AGTGGGAGACAGGGGGTACCGGG No data
1039816336_1039816345 15 Left 1039816336 8:41097874-41097896 CCAGTGAGAAACATCCCAGTGAG No data
Right 1039816345 8:41097912-41097934 TTCTGGGAAGTGGGAGACAGGGG No data
1039816336_1039816349 30 Left 1039816336 8:41097874-41097896 CCAGTGAGAAACATCCCAGTGAG No data
Right 1039816349 8:41097927-41097949 GACAGGGGGTACCGGGACATCGG No data
1039816336_1039816342 6 Left 1039816336 8:41097874-41097896 CCAGTGAGAAACATCCCAGTGAG No data
Right 1039816342 8:41097903-41097925 CAGCAATCGTTCTGGGAAGTGGG No data
1039816336_1039816346 16 Left 1039816336 8:41097874-41097896 CCAGTGAGAAACATCCCAGTGAG No data
Right 1039816346 8:41097913-41097935 TCTGGGAAGTGGGAGACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039816336 Original CRISPR CTCACTGGGATGTTTCTCAC TGG (reversed) Intergenic
No off target data available for this crispr